X

Uso de cookies
Este sitio web almacena cookies en su ordenador. Estas cookies se utilizan para recopilar información acerca de la forma en que usted interactúa con nuestro sitio web y recordarlo. Usamos esta información para personalizar y mejorar su experiencia de navegación y para realizar análisis y recuento de los visitantes, tanto en este sitio web como a través de otros medios. Para obtener más información sobre las cookies que utilizamos, así como cambiar su configuración, consulte nuestra Política de Cookies.

CGT 600/250 Versión 1.2

GenEnfermedadTranscritoMutacionesproductos
ABCA4Distrofia de conos y bastones tipo 3NM_000350.2NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>T250,600
ABCA4Retinosis pigmentaria tipo 19NM_000350.2NM_000350.2:c.1848delA250,600
ABCA4Enfermedad de Stargardt tipo 1NM_000350.2NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>G250,600
ABCB7Anemia sideroblástica ligada al X con ataxiaNM_004299.4NM_004299.4:c.1203T>G, NM_004299.4:c.1234G>C, NM_004299.4:c.1300G>A600
ACAD9Déficit de acil-CoA deshidrogenasa tipo 9NM_014049.4NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>A250,600
ACADMDéficit de acil-CoA deshidrogenasa de cadena mediaNM_000016.5NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>T250,600
ACADSDéficit de acil-CoA deshidrogenasa de cadena cortaNM_000017.2NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>A250,600
ACADSBDéficit de 2-metilbutiril-CoA deshidrogenasaNM_001609.3NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A250,600
ACADVLDéficit de acil-CoA deshidrogenasa de cadena muy largaNM_000018.3NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>C250,600
ACAT1Cetoacidosis por déficit de beta-cetotiolasaNM_000019.3NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>A, NM_000019.3:c.2T>A, NM_000019.3:c.410_417delCTCAAAGT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delA600
ACEDisgenesia tubular renalNM_000789.3NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>G250,600
ACOX1Déficit de acil CoA oxidasa peroxisomalNM_004035.6NM_004035.6:c.832A>G, NM_004035.6:c.532G>T, NM_004035.6:c.591delG600
ACTN4Glomeruloesclerosis focal segmental tipo 1NM_004924.4NM_004924.4:c.763A>G, NM_004924.4:c.2619_2620insC, NM_004924.4:c.776C>T, NM_004924.4:c.784T>C600
ADADéficit de adenosina desaminasaNM_000022.2NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>T250,600
ADAMTS2Síndrome de Ehlers-Danlos tipo 7CNM_014244.4NM_014244.4:c.2384G>A600
ADAMTSL2Displasia geleofísica tipo 1NM_014694.3NM_014694.3:c.338G>A, NM_014694.3:c.440C>T, NM_014694.3:c.661C>T, NM_014694.3:c.340G>A600
ADCK3Deficiencia primaria de coenzima Q10 tipo 4NM_020247.4NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A250,600
AGAAspartilglucosaminuriaNM_000027.3NM_000027.3:c.488G>C, NM_000027.3:c.755G>A, NM_000027.3:c.214T>C, NM_000027.3:c.302C>T, NM_000027.3:c.800dupT, NM_000027.3:c.904G>A600
AGLEnfermedad de almacenamiento de glucógeno tipo 3NM_000642.2NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>G250,600
AGPSCondrodisplasia punctata rizomélica tipo 3NM_003659.3NM_003659.3:c.1256G>A, NM_003659.3:c.926C>T, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>T600
AGTDisgenesia tubular renalNM_000029.3NM_000029.3:c.1124G>A, NM_000029.3:c.604C>T, NM_000029.3:c.1290_1291insT, NM_000029.3:c.1290delT600
AGTR1Disgenesia tubular renalNM_031850.3NM_031850.3:c.481delC, NM_031850.3:c.259dupG, NM_031850.3:c.215dupT, NM_031850.3:c.481C>T600
AGXTHiperoxaluria primaria tipo 1NM_000030.2NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>G250,600
AHI1Síndrome de Joubert tipo 3NM_017651.4NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>T250,600
AIPL1Distrofia de conos y bastonesNM_014336.4NM_014336.4:c.1053_1064delTGCAGAGCCACC250,600
AIPL1Amaurosis congénita de Leber tipo 4NM_014336.4NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>C250,600
ALAS2Protoporfiria eritropoyéticaNM_000032.4NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1706_1709delAGTG600
ALAS2Anemia sideroblástica ligada al XNM_000032.4NM_000032.4:c.1354C>T600
ALDH4A1Hiperprolinemia tipo 2NM_003748.3NM_003748.3:c.1055C>T600
ALDH5A1Deficiencia de la succinico semialdehido deshidrogenasaNM_001080.3NM_001080.3:c.1234C>T, NM_001080.3:c.1226G>A, NM_001080.3:c.901A>G, NM_001080.3:c.1540C>T, NM_001080.3:c.1579C>T, NM_001080.3:c.612G>A, NM_001080.3:c.803G>A, NM_001080.3:c.862A>G600
ALDOAEnfermedad de almacenamiento de glucógeno tipo 12NM_000034.3NM_000034.3:c.619G>A, NM_000034.3:c.386A>G600
ALDOBIntolerancia hereditaria a la fructosaNM_000035.3NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>A250,600
ALG1Trastorno congénito de la glicosilación tipo 1kNM_019109.4NM_019109.4:c.1187+1G>A, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>T600
ALG6Trastorno congénito de la glicosilación tipo 1cNM_013339.3NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>C250,600
ALMS1Síndrome de AlströmNM_015120.4NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>T250,600
ALPLHipofosfatasiaNM_000478.4NM_000478.4:c.1001G>A, NM_000478.4:c.1366G>A, NM_000478.4:c.211C>T, NM_000478.4:c.212G>C, NM_000478.4:c.323C>T, NM_000478.4:c.346G>A, NM_000478.4:c.407G>A, NM_000478.4:c.526G>A, NM_000478.4:c.535G>A, NM_000478.4:c.571G>A, NM_000478.4:c.620A>C, NM_000478.4:c.1133A>T, NM_000478.4:c.1250A>G, NM_000478.4:c.1306T>C, NM_000478.4:c.98C>T, NM_000478.4:c.1574delG, NM_000478.4:c.892G>A, NM_000478.4:c.814C>T, NM_000478.4:c.881A>C600
AMACRDéficit de Alfa-metilacil-CoA racemasaNM_014324.5NM_014324.5:c.857delT, NM_014324.5:c.320T>C, NM_014324.5:c.43delG, NM_014324.5:c.154T>C600
AMTEncefalopatía por glicinaNM_000481.3NM_000481.3:c.139G>A, NM_000481.3:c.125A>G, NM_000481.3:c.959G>A, NM_000481.3:c.574C>T, NM_000481.3:c.806G>A, NM_000481.3:c.826G>C, NM_000481.3:c.259-1G>C600
ANO5Distrofia muscular de cinturas tipo 2L autosómica recesivaNM_213599.2NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insA250,600
APTXAtaxia con apraxia oculomotora tipo 1NM_175073.2NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>A250,600
ARSíndrome de insensibilidad a los andrógenosNM_000044.3NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>G250,600
ARG1ArgininemiaNM_000045.3NM_000045.3:c.61C>T, NM_000045.3:c.365G>A, NM_000045.3:c.413G>T, NM_000045.3:c.871C>T, NM_000045.3:c.32T>C, NM_000045.3:c.703G>C, NM_000045.3:c.869C>G600
ARL13BSíndrome de Joubert tipo 8NM_182896.2NM_182896.2:c.1186C>G, NM_182896.2:c.246G>A, NM_182896.2:c.1252C>T, NM_182896.2:c.598C>T600
ARL6Síndrome Bardet-Biedl tipo 3NM_177976.2NM_177976.2:c.4G>T, NM_177976.2:c.92C>G, NM_177976.2:c.281T>C, NM_177976.2:c.92C>T, NM_177976.2:c.431C>T, NM_177976.2:c.364C>T600
ARL6Retinosis pigmentaria tipo 55NM_177976.2NM_177976.2:c.266C>T600
ARSALeucodistrofia metacromáticaNM_000487.5NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>A250,600
ARSBMucopolisacaridosis tipo 6NM_000046.3NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delA250,600
ARSECondrodisplasia punctata tipo 1 ligada al XNM_000047.2NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>T250,600
ARXEncefalopatía epiléptica infantil temprana tipo 1NM_139058.2NM_139058.2:c.1058C>T600
ARXLisencefalia ligada al X con anomalías genitalesNM_139058.2NM_139058.2:c.980_983delAACA600
ASLAciduria argininosuccínicaNM_000048.3NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>T250,600
ASPAEnfermedad de CanavanNM_000049.2NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>G250,600
ASPMMicrocefalia primaria tipo 5 autosómica recesivaNM_018136.4NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>C250,600
ASS1Citrulinemia tipo 1NM_000050.4NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>T250,600
ATICAICA ribosiduriaNM_004044.6NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delG250,600
ATP7AEnfermedad de MenkesNM_000052.6NM_000052.6:c.2938C>T, NM_000052.6:c.2531G>A, NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3915_3921delCTCCCCA, NM_000052.6:c.3931A>G600
ATP7ASíndrome del cuerno occipitalNM_000052.6NM_000052.6:c.3911A>G600
ATP7AAtrofia muscular espinal distal ligada al XNM_000052.6NM_000052.6:c.2981C>T600
ATP7BEnfermedad de WilsonNM_000053.3NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>T250,600
ATRSíndrome de Seckel tipo 1NM_001184.3NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>T250,600
AUHAciduria 3-metilglutacónica tipo 1NM_001698.2NM_001698.2:c.471delT, NM_001698.2:c.559G>A, NM_001698.2:c.589C>T, NM_001698.2:c.650G>A, NM_001698.2:c.895-1G>A, NM_001698.2:c.991A>T, NM_001698.2:c.656-2A>G, NM_001698.2:c.943-2A>G600
B4GALT1Trastorno congénito de la glicosilación tipo 2dNM_001497.3NM_001497.3:c.1031dupC600
B9D2Síndrome de Meckel tipo 10NM_030578.3NM_030578.3:c.301A>C600
BCKDHAEnfermedad de la orina con olor a jarabe de arce tipo 1ANM_000709.3NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delA250,600
BCKDHBEnfermedad de la orina con olor a jarabe de arce tipo 1BNM_183050.2NM_183050.2:c.1046G>A, NM_183050.2:c.547C>T, NM_183050.2:c.509G>A, NM_183050.2:c.526A>T, NM_183050.2:c.344-1G>A, NM_183050.2:c.1114G>T, NM_183050.2:c.302G>A, NM_183050.2:c.342T>G, NM_183050.2:c.508C>A, NM_183050.2:c.508C>G, NM_183050.2:c.508C>T, NM_183050.2:c.748G>T, NM_183050.2:c.752T>C, NM_183050.2:c.799C>T, NM_183050.2:c.548G>C, NM_183050.2:c.884delT, NM_183050.2:c.902T>G, NM_183050.2:c.952-1G>A, NM_183050.2:c.853C>T, NM_183050.2:c.832G>A, NM_183050.2:c.356T>G, NM_183050.2:c.970C>T, NM_183050.2:c.488A>T, NM_183050.2:c.479T>G600
BCS1LSíndrome de BjörnstadtNM_004328.4NM_004328.4:c.548G>A250,600
BCS1LSíndrome GRACILENM_004328.4NM_004328.4:c.232A>G250,600
BCS1LDeficiencia del complejo mitocondrial III nuclear, tipo 1NM_004328.4NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>T250,600
BEST1BestrofinopatíaNM_004183.3NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTG250,600
BEST1Retinosis pigmentaria tipo 50NM_004183.3NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delG250,600
BEST1Distrofia macular viteliforme tipo 2NM_004183.3NM_004183.3:c.122T>C, NM_004183.3:c.422G>A250,600
BRCA2Anemia de Fanconi grupo de complementación D1NM_000059.3NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insT250,600
BRIP1Anemia de Fanconi grupo de complementación JNM_032043.2NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>T250,600
BSCL2Lipodistrofia congénita de Berardinelli-SeipNM_032667.6NM_032667.6:c.634G>C, NM_032667.6:c.412C>T, NM_032667.6:c.782_783insG, NM_032667.6:c.823C>T, NM_032667.6:c.985C>T, NM_032667.6:c.672-3C>G, NM_032667.6:c.974_975insG, NM_032667.6:c.671+5G>A600
BSCL2Síndrome neurodegenerativo grave con lipodistrofiaNM_032667.6NM_032667.6:c.793C>T600
BSNDSíndrome de Bartter tipo 4ANM_057176.2NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>A250,600
BTDDéficit de biotinidasaNM_000060.3NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>A250,600
BTKAgammaglobulinemia ligada al XNM_000061.2NM_000061.2:c.1275C>A, NM_000061.2:c.1506C>A, NM_000061.2:c.1125T>G, NM_000061.2:c.1223T>C, NM_000061.2:c.1288A>G, NM_000061.2:c.1082A>G, NM_000061.2:c.763C>T, NM_000061.2:c.1516T>C, NM_000061.2:c.718G>T, NM_000061.2:c.755G>A, NM_000061.2:c.1766A>G, NM_000061.2:c.1773C>A, NM_000061.2:c.1558C>T, NM_000061.2:c.1559G>A, NM_000061.2:c.1889T>A, NM_000061.2:c.1906G>T, NM_000061.2:c.338T>A, NM_000061.2:c.1820C>A, NM_000061.2:c.862C>T, NM_000061.2:c.919A>G, NM_000061.2:c.1838G>A, NM_000061.2:c.1001A>C600
C10orf2Ataxia espinocerebelosa infantilNM_021830.4NM_021830.4:c.1523A>G600
C10orf2Síndrome de depleción del ADN mitocondrial, forma hepato-cerebro-renalNM_021830.4NM_021830.4:c.1287C>T, NM_021830.4:c.952G>A, NM_021830.4:c.1370C>T, NM_021830.4:c.524_525insG600
C10orf2Neuropatía atáxica sensitiva - disartria - oftalmoplejíaNM_021830.4NM_021830.4:c.955A>G600
C3Síndrome hemolítico urémico atípico con anomalía C3NM_000064.2NM_000064.2:c.2562C>G600
C3Déficit de C3NM_000064.2NM_000064.2:c.2354+1G>A, NM_000064.2:c.4851-1G>A, NM_000064.2:c.1119+1G>T, NM_000064.2:c.3116dupT, NM_000064.2:c.3627_3628insGGGGCCC, NM_000064.2:c.1004-2A>T600
CA2Osteopetrosis autosómica recesiva tipo 3NM_000067.2NM_000067.2:c.663+2T>C, NM_000067.2:c.319C>T, NM_000067.2:c.120T>G600
CAPN3Distrofia muscular de cinturas tipo 2ANM_000070.2NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG250,600
CBSHomocistinuriaNM_000071.2NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>C250,600
CC2D2ASíndrome de Joubert tipo 9NM_001080522.2NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delG250,600
CC2D2ASíndrome de Meckel tipo 6NM_001080522.2NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>C250,600
CD2APGlomerulosis focal segmentaria tipo 3NM_012120.2NM_012120.2:c.730-1delGinsCT, NM_012120.2:c.1575_1577delAGA, NM_012120.2:c.1488G>A600
CD40LGSíndrome de hiper-IgM ligado al XNM_000074.2NM_000074.2:c.386A>G, NM_000074.2:c.368C>A, NM_000074.2:c.384T>A, NM_000074.2:c.632C>A, NM_000074.2:c.107T>G600
CDH23Sordera tipo 12 autosómica recesivaNM_022124.5NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>A250,600
CDH23Síndrome de Usher tipo 1DNM_022124.5NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>A250,600
CDH3Displasia ectodérmica - ectrodactilia - distrofia macularNM_001793.4NM_001793.4:c.455_456insC, NM_001793.4:c.981delG, NM_001793.4:c.1508G>A, NM_001793.4:c.965A>T, NM_001793.4:c.830delG, NM_001793.4:c.965A>G600
CDHR1Retinosis pigmentaria tipo 65NM_033100.3NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delG250,600
CDK5RAP2Microcefalia primaria tipo 3 autosómica recesivaNM_018249.5NM_018249.5:c.4661_4662insTATT, NM_018249.5:c.246T>A, NM_018249.5:c.4546G>T, NM_018249.5:c.127+1G>C, NM_018249.5:c.4672C>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.700G>T600
CENPJMicrocefalia primaria tipo 6 autosómica recesivaNM_018451.4NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupA250,600
CEP152Microcefalia primaria tipo 9 autosómica recesivaNM_014985.3NM_014985.3:c.794A>C, NM_014985.3:c.749_750delGA600
CEP152Síndrome de Seckel tipo 5NM_014985.3NM_014985.3:c.2034T>G, NM_014985.3:c.1578-1G>A600
CEP290Síndrome de Joubert tipo Senior-LokenNM_025114.3NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCA250,600
CEP290Síndrome de Joubert tipo 5NM_025114.3NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>T250,600
CEP290Amaurosis congénita de Leber tipo 10NM_025114.3NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>T250,600
CEP290Síndrome de Meckel tipo 4NM_025114.3NM_025114.3:c.613C>T250,600
CERKLRetinosis pigmentaria tipo 26NM_201548.4NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGA250,600
CFHInmunodeficiencia con anomalía de factor HNM_000186.3NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>C250,600
CFTRFibrosis quísticaNM_000492.3NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>T250,600
CHST6Distrofia corneal macularNM_021615.4NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>A250,600
CLCN1Miotonía congénita, autosómico recesivaNM_000083.2NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>T250,600
CLCN7Osteopetrosis autosómica recesiva tipo 4NM_001287.5NM_001287.5:c.622C>T, NM_001287.5:c.781A>T600
CLDN14Sordera autosómica recesiva tipo 29NM_144492.2NM_144492.2:c.254T>A, NM_144492.2:c.301G>A, NM_144492.2:c.398delT600
CLDN19Hipomagnesemia tipo 5, renal con afectación ocular graveNM_148960.2NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>A250,600
CLN3Lipofuscinosis neuronal ceroide tipo 3NM_001042432.1NM_001042432.1:c.883G>A, NM_001042432.1:c.597C>A, NM_001042432.1:c.622_623insT, NM_001042432.1:c.1272delG, NM_001042432.1:c.1210C>A600
CLN5Lipofuscinosis neuronal ceroide tipo 5NM_006493.2NM_006493.2:c.619T>C, NM_006493.2:c.335G>A, NM_006493.2:c.377G>A, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.335G>C, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.955_970delGGAAATGAAACATCTG, NM_006493.2:c.835G>A, NM_006493.2:c.526dupA, NM_006493.2:c.1026C>A, NM_006493.2:c.524T>G, NM_006493.2:c.433C>T600
CLN6Lipofuscinosis neuronal ceroide tipo 6NM_017882.2NM_017882.2:c.200T>C, NM_017882.2:c.214G>C, NM_017882.2:c.139C>T, NM_017882.2:c.307C>T, NM_017882.2:c.214G>T, NM_017882.2:c.663C>G600
CLN8Lipofuscinosis neuronal ceroide tipo 8NM_018941.3NM_018941.3:c.88delG, NM_018941.3:c.789G>C, NM_018941.3:c.610C>T, NM_018941.3:c.88G>C600
CLRN1Retinosis pigmentaria tipo 61NM_174878.2NM_174878.2:c.92C>T250,600
CLRN1Síndrome de Usher tipo 3ANM_174878.2NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>G250,600
CNGA1Retinosis pigmentaria tipo 49NM_000087.3NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>A250,600
CNGB1Retinosis pigmentaria tipo 45NM_001297.4NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>T250,600
CNGB3Acromatopsia tipo 3NM_019098.4NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA250,600
CNGB3Degeneración macular juvenilNM_019098.4NM_019098.4:c.1405T>G250,600
COL11A1Síndrome de Stickler tipo 2NM_001854.3NM_001854.3:c.1750dupG, NM_001854.3:c.2350G>C, NM_001854.3:c.4606C>G, NM_001854.3:c.4642C>G, NM_001854.3:c.3709-1G>A600
COL17A1Epidermólisis ampollosa juntural tipo no HerlitzNM_000494.3NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGG250,600
COL18A1Síndrome de Knobloch tipo 1NM_030582.3NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insG250,600
COL1A2Síndrome de Ehlers-Danlos tipo cardiaco valvularNM_000089.3NM_000089.3:c.3601G>T, NM_000089.3:c.1404+1G>A, NM_000089.3:c.559G>C, NM_000089.3:c.133-1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.240_247delGTATGATG, NM_000089.3:c.293_294insC600
COL2A1Displasia oto-espondilo-megaepifisariaNM_001844.4NM_001844.4:c.1052delG, NM_001844.4:c.3106C>T600
COL4A3Síndrome de Alport autosómico recesivoNM_000091.4NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>T250,600
COL4A4Síndrome de Alport autosómico recesivoNM_000092.4NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A250,600
COL7A1Epidermólisis bullosa distrófica tipo Hallopeu-SiemensNM_000094.3NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>T250,600
COL9A1Síndrome de Stickler tipo 4NM_001851.4NM_001851.4:c.883C>T, NM_001851.4:c.706C>T600
COL9A2Síndrome de Stickler tipo 5NM_001852.3NM_001852.3:c.1918C>T, NM_001852.3:c.1097_1098insC, NM_001852.3:c.793-1G>C600
COQ2Deficiencia primaria de coenzima Q10 tipo 1NM_015697.7NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>G250,600
CPS1Déficit de carbamil-fosfato sintetasa tipo 1NM_001875.4NM_001875.4:c.1912C>T, NM_001875.4:c.697C>T, NM_001875.4:c.1631C>T, NM_001875.4:c.3556delA600
CPT1ADéficit de carnitina palmitoiltransferasa tipo 1ANM_001876.3NM_001876.3:c.1216C>T, NM_001876.3:c.1241C>T, NM_001876.3:c.1361A>G, NM_001876.3:c.222C>A, NM_001876.3:c.1079A>G, NM_001876.3:c.1436C>T, NM_001876.3:c.1493A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.1393G>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.1538C>T, NM_001876.3:c.298C>T600
CPT2Déficit de carnitina palmitoiltransferasa tipo 2NM_000098.2NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A250,600
CRB1Amaurosis congénita de Leber tipo 8NM_201253.2NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAG250,600
CRB1Atrofia coriorretiniana paravenosa pigmentadaNM_201253.2NM_201253.2:c.484G>A250,600
CRB1Retinosis pigmentaria tipo 12NM_201253.2NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>T250,600
CRLF1Síndrome de sudoración inducida por fríoNM_004750.4NM_004750.4:c.538C>T, NM_004750.4:c.303delC, NM_004750.4:c.413C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.226T>G, NM_004750.4:c.829C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.713_714insC, NM_004750.4:c.1125delG, NM_004750.4:c.676dupA, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.935G>A, NM_004750.4:c.1137C>G, NM_004750.4:c.845_846delTG600
CRTAPOsteogénesis imperfecta tipo 7NM_006371.4NM_006371.4:c.826C>T, NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>T600
CRXAmaurosis congénita de Leber tipo 7NM_000554.4NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>C250,600
CSTBEpilepsia mioclónica progresiva tipo 1ANM_000100.3NM_000100.3:c.212A>C, NM_000100.3:c.202C>T600
CTNSCistinosis ocular no nefropáticaNM_004937.2NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>G250,600
CTNSCistinosis nefropáticaNM_004937.2NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>A250,600
CTSDLipofuscinosis neuronal ceroide tipo 10NM_001909.4NM_001909.4:c.685T>A, NM_001909.4:c.1149G>C600
CTSKPicnodisostosisNM_000396.3NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>T250,600
CYP21A2Hiperplasia suprarrenal congénita clásica por déficit de 21-hidroxilasa-hybrid 5'CYP21A1P/3'CYP21A2, hybrid 5'CYP21A2/3'CYP21A1P (Detección por MPLA)600
CYP21A2Hiperplasia suprarrenal congénita clásica por déficit de 21-hidroxilasaNM_000500.7NM_000500.7:c.518T>A, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.719T>A, NM_000500.7:c.[713T>A;719T>A], NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.923_924insT, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.713T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A (Detección por minisecuenciación)600
CYP21A2Hiperplasia suprarrenal congénita no clásica por déficit de 21-hidroxilasaNM_000500.7NM_000500.7:c.92C>T, NM_000500.7:c.844G>T, NM_000500.7:c.1360C>T (Detección por minisecuenciación)600
CYP4V2Distrofia cristalina corneoretinal de BiettiNM_207352.3NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C250,600
CYP7B1Defecto congénito en la síntesis de ácidos biliares tipo 3NM_004820.3NM_004820.3:c.1162C>T250,600
CYP7B1Paraplejía espástica tipo 5A autosómica recesivaNM_004820.3NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>T250,600
D2HGDHAciduria D-2-hidroxiglutáricaNM_152783.4NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>C250,600
DBTEnfermedad de la orina con olor a jarabe de arce tipo 2NM_001918.3NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>G250,600
DCLRE1CSíndrome de OmennNM_001033855.2NM_001033855.2:c.2T>C250,600
DCLRE1CInmunodeficiencia combinada grave por déficit de DCLRE1CNM_001033855.2NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insA250,600
DDB2Xeroderma pigmentosa grupo de complementación ENM_000107.2NM_000107.2:c.730A>G, NM_000107.2:c.937C>T, NM_000107.2:c.818G>A, NM_000107.2:c.919G>T600
DDCDéficit de L-aminoácido aromático decarboxilasaNM_000790.3NM_000790.3:c.100delG, NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.749C>T600
DFNB31Sordera tipo 31 autosómica recesivaNM_015404.3NM_015404.3:c.1135C>T, NM_015404.3:c.817C>T250,600
DFNB59Sordera tipo 59 autosómica recesivaNM_001042702.3NM_001042702.3:c.122delA, NM_001042702.3:c.420delT, NM_001042702.3:c.113dupT, NM_001042702.3:c.988delG, NM_001042702.3:c.726delT, NM_001042702.3:c.161C>T, NM_001042702.3:c.817_818insT600
DGUOKSíndrome de depleción del ADN mitocondrial tipo 3NM_080916.2NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>T250,600
DHCR7Síndrome de Smith-Lemli-OpitzNM_001360.2NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>C250,600
DHDDSRetinosis pigmentaria tipo 59NM_024887.3NM_024887.3:c.328delA, NM_024887.3:c.998C>G, NM_024887.3:c.124A>G600
DKC1Disqueratosis congénita ligada al XNM_001363.4NM_001363.4:c.91C>A, NM_001363.4:c.214_215delCTinsTA, NM_001363.4:c.194G>C, NM_001363.4:c.838A>C, NM_001363.4:c.91C>G, NM_001363.4:c.196A>G600
DKC1Síndrome de Hoyeraal-HreidarssonNM_001363.4NM_001363.4:c.200C>T, NM_001363.4:c.204C>A600
DLDDéficit de dihidrolipoamida deshidrogenasa E3NM_000108.4NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.105_106insA, NM_000108.4:c.1483A>G600
DLL3Disostosis espondilocostal tipo 1NM_016941.3NM_016941.3:c.231C>A, NM_016941.3:c.712C>T600
DMDDistrofia muscular de BeckerNM_004006.2NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.137A>T600
DMDDistrofia muscular de Becker-insBecker, delBecker (Detección por MLPA)600
DMDMiocardiopatía dilatada familiar tipo 3BNM_004006.2NM_004006.2:c.5922+3G>C600
DMDDistrofia muscular de DuchenneNM_004006.2NM_004006.2:c.1261C>T, NM_004006.2:c.1286C>A, NM_004006.2:c.1070delC, NM_004006.2:c.10086+1G>A, NM_004006.2:c.1886C>A, NM_004006.2:c.1900A>T, NM_004006.2:c.10774delA, NM_004006.2:c.204dupC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.10141C>T, NM_004006.2:c.10033C>T, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.1012G>T, NM_004006.2:c.1048G>T, NM_004006.2:c.2302C>T, NM_004006.2:c.1734delA, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2479delG, NM_004006.2:c.2482T>G, NM_004006.2:c.2484T>G, NM_004006.2:c.251delT, NM_004006.2:c.2523delA, NM_004006.2:c.10446_10447delCT, NM_004006.2:c.2650C>T, NM_004006.2:c.10454delT, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.1306dupG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.133C>T, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.2547delT, NM_004006.2:c.1371delG, NM_004006.2:c.2755A>T, NM_004006.2:c.2758C>T, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.160_162delCTC, NM_004006.2:c.3295C>T, NM_004006.2:c.6182delC, NM_004006.2:c.6226G>T, NM_004006.2:c.3639dupA, NM_004006.2:c.199G>T, NM_004006.2:c.3747delG, NM_004006.2:c.2125delC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.4117C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.4375C>T, NM_004006.2:c.4405C>T, NM_004006.2:c.2332C>T, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4486delG, NM_004006.2:c.4500delA, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4735G>T, NM_004006.2:c.4806A>T, NM_004006.2:c.4843A>T, NM_004006.2:c.489G>A, NM_004006.2:c.5287C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.5313dupT, NM_004006.2:c.5353C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5530C>T, NM_004006.2:c.5554C>T, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5640T>A, NM_004006.2:c.5671A>T, NM_004006.2:c.5697delA, NM_004006.2:c.5773G>T, NM_004006.2:c.5807T>A, NM_004006.2:c.583C>T, NM_004006.2:c.8944C>T, NM_004006.2:c.1489C>T, NM_004006.2:c.6000T>A, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.615T>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9361+1G>A, NM_004006.2:c.6238delC, NM_004006.2:c.3697delC, NM_004006.2:c.6292C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.4071G>C, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6392_6393insCA, NM_004006.2:c.433C>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.6834delT, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.6936delA, NM_004006.2:c.6943G>T, NM_004006.2:c.6964delG, NM_004006.2:c.6982A>T, NM_004006.2:c.6986dupA, NM_004006.2:c.7682G>A, NM_004006.2:c.7683G>A, NM_004006.2:c.7764dupT, NM_004006.2:c.7771G>T, NM_004006.2:c.7894C>T, NM_004006.2:c.7922delA, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.8069T>G, NM_004006.2:c.8086delC, NM_004006.2:c.8358G>A, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8443C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8608C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8656C>T, NM_004006.2:c.8668G>A, NM_004006.2:c.8713C>T, NM_004006.2:c.3121C>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9337C>T, NM_004006.2:c.6906G>A, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9380C>G, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9568C>T, NM_004006.2:c.9612_9613ins341, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9767dupG, NM_004006.2:c.9851G>A, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.2866C>T, NM_004006.2:c.2929dupC, NM_004006.2:c.3022A>T, NM_004006.2:c.2816T>A, NM_004006.2:c.3087G>A, NM_004006.2:c.5899C>T, NM_004006.2:c.3124A>T, NM_004006.2:c.3076G>T, NM_004006.2:c.6373C>T, NM_004006.2:c.627delA, NM_004006.2:c.2137C>T, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.220delC, NM_004006.2:c.2169-3_2169-1delinsAA, NM_004006.2:c.6340A>T, NM_004006.2:c.6763-2A>G600
DMDDistrofia muscular de Duchenne-insDuchenne, delDuchenne (Detección por MLPA)600
DMP1Raquitismo hipofosfatémico autosómico recesivo tipo 1NM_004407.3NM_004407.3:c.1A>G, NM_004407.3:c.55-1G>C, NM_004407.3:c.31delT, NM_004407.3:c.362delC600
DNAJC19Miocardiopatía dilatada con ataxiaNM_145261.3NM_145261.3:c.300delA600
DPAGT1Trastorno congénito de la glicosilación tipo IjNM_001382.3NM_001382.3:c.791T>G, NM_001382.3:c.358C>A, NM_001382.3:c.643+1G>A, NM_001382.3:c.902G>A, NM_001382.3:c.349G>A, NM_001382.3:c.980_981delCT600
DPM1Trastorno congénito de la glicosilación tipo 1eNM_003859.1NM_003859.1:c.564-1G>A, NM_003859.1:c.628delC, NM_003859.1:c.274C>G, NM_003859.1:c.679-1G>T, NM_003859.1:c.742T>C600
DPYDDéficit de dihidropirimidina deshidrogenasaNM_000110.3NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>T250,600
DSPCardiomiopatía arritmogénicaNM_004415.2NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>T250,600
DSPCardiomiopatía dilatada con cabello lanoso y queratodermiaNM_004415.2NM_004415.2:c.5513G>A250,600
DSPEpidermólisis bullosa acantolítica letalNM_004415.2NM_004415.2:c.5800C>T250,600
DYSFDisferlinopatíaNM_003494.3NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delG250,600
DYSFMiopatía de MiyoshiNM_003494.3NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>T250,600
DYSFDistrofia Muscular de las Cinturas de tipo 2BNM_003494.3NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>A250,600
EDADisplasia ectodérmica hipohidrótica ligada al XNM_001399.4NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>A250,600
EDN3Síndrome de Shah-Waardenburg tipo 4BNM_207034.1NM_207034.1:c.277C>G, NM_207034.1:c.568_569delGA, NM_207034.1:c.262_263delGCinsT, NM_207034.1:c.559_560insA, NM_207034.1:c.565_566insA, NM_207034.1:c.476G>T600
EDNRBSíndrome de Shah-Waardenburg tipo 4ANM_000115.3NM_000115.3:c.914C>A, NM_000115.3:c.548C>G, NM_000115.3:c.828G>T, NM_000115.3:c.-51-946delC600
EGR2Enfermedad de Charcot-Marie-Tooth tipo 4ENM_000399.3NM_000399.3:c.803T>A600
EIF2AK3Síndrome de Wolcott-RallisonNM_004836.5NM_004836.5:c.994G>T, NM_004836.5:c.1763G>A600
EMDDistrofia muscular de Emery-Dreifuss tipo 1, ligada al XNM_000117.2NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGC600
ENO3Enfermedad de almacenamiento de glucógeno tipo 13NM_053013.3NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>C250,600
ENPP1Calcificación arterial generalizada de la infancia y pseudoxantoma elasticoNM_006208.2NM_006208.2:c.1612G>C600
ENPP1Raquitismo hipofosfatémico autosómico recesivo tipo 2NM_006208.2NM_006208.2:c.797G>T, NM_006208.2:c.2702A>C600
ENPP1Calcificación arterial generalizada de la infanciaNM_006208.2NM_006208.2:c.1112A>T, NM_006208.2:c.1025G>T, NM_006208.2:c.783C>G, NM_006208.2:c.2677G>T, NM_006208.2:c.913C>A, NM_006208.2:c.2230C>T, NM_006208.2:c.900G>A600
ERCC2TricotiodistrofiaNM_000400.3NM_000400.3:c.1972C>T250,600
ERCC2Xeroderma pigmentosa grupo de complementación DNM_000400.3NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A250,600
ERCC3Xeroderma pigmentosa grupo de complementación BNM_000122.1NM_000122.1:c.1633C>T, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.296T>C, NM_000122.1:c.1273C>T, NM_000122.1:c.1757delA, NM_000122.1:c.1858delG600
ERCC4Xeroderma pigmentosa grupo de complementación FNM_005236.2NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>T250,600
ERCC5Xeroderma pigmentosa grupo de complementación GNM_000123.3NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delA250,600
ERCC6Síndrome cerebro-óculo-facio-esquelético tipo1NM_000124.3NM_000124.3:c.2047C>T250,600
ERCC6Síndrome de Cockayne tipo BNM_000124.3NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>T250,600
ERCC8Síndrome de Cockayne tipo ANM_000082.3NM_000082.3:c.1103_1108delAGTTinsTTATATGAACCTTATATGAA, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.613G>C, NM_000082.3:c.966C>A, NM_000082.3:c.37G>T600
ESCO2Síndrome de RobertsNM_001017420.2NM_001017420.2:c.1615T>G, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1597dupT, NM_001017420.2:c.505C>T, NM_001017420.2:c.291_292insGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.874_877delGACA600
ESCO2Síndrome de SC focomeliaNM_001017420.2NM_001017420.2:c.1269G>A, NM_001017420.2:c.604C>T600
ESPNSordera tipo 36 autosómica recesivaNM_031475.2NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2230G>A, NM_031475.2:c.2470_2473delTCAG600
ESRRBSordera tipo 35 autosómica recesivaNM_004452.3NM_004452.3:c.329C>T600
ETFAAcidemia glutárica tipo 2ANM_000126.3NM_000126.3:c.470T>G, NM_000126.3:c.797C>T600
ETFBAcidemia glutárica tipo 2BNM_001985.2NM_001985.2:c.278_279insG, NM_001985.2:c.490C>T, NM_001985.2:c.491G>A, NM_001985.2:c.382G>A, NM_001985.2:c.58-53_58-52insG, NM_001985.2:c.61C>T, NM_001985.2:c.614_616delAGA600
ETFDHAcidemia glutárica tipo 2CNM_004453.3NM_004453.3:c.1823delG, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.2T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.250G>A, NM_004453.3:c.1351G>C, NM_004453.3:c.1367C>T, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1773_1774delAT, NM_004453.3:c.1832G>A, NM_004453.3:c.508G>T, NM_004453.3:c.413T>G, NM_004453.3:c.643G>A600
ETHE1Encefalopatía etilmalónicaNM_014297.3NM_014297.3:c.487C>T, NM_014297.3:c.554T>G, NM_014297.3:c.440_450delACAGCATGGCC, NM_014297.3:c.604dupG, NM_014297.3:c.221dupA, NM_014297.3:c.488G>A600
EYSRetinosis pigmentaria tipo 25NM_001142800.1NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>A250,600
F11Déficit del factor 11NM_000128.3NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>A250,600
F5Déficit del factor 5NM_000130.4NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>T250,600
F5TrombosisNM_000130.4NM_000130.4:c.1000A>G250,600
F8Hemofilia ANM_000132.3NM_000132.3:c.1075_1078delAATG, NM_000132.3:c.1042T>C, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.120delC, NM_000132.3:c.1214T>G, NM_000132.3:c.1090G>A, NM_000132.3:c.1207C>G, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1175C>A, NM_000132.3:c.1335dupC, NM_000132.3:c.1203G>A, NM_000132.3:c.128dupT, NM_000132.3:c.1331A>C, NM_000132.3:c.1301G>A, NM_000132.3:c.1234T>C, NM_000132.3:c.1316G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1310delG, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1420G>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1438_1439delCT, NM_000132.3:c.1440_1441insA, NM_000132.3:c.144-11T>G, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1175C>G, NM_000132.3:c.1324T>A, NM_000132.3:c.1324T>C, NM_000132.3:c.1325A>G, NM_000132.3:c.144-5C>G, NM_000132.3:c.1463C>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1467_1472dupCAGACC, NM_000132.3:c.1477A>G, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1560delT, NM_000132.3:c.1564_1565delATinsTA, NM_000132.3:c.1585A>G, NM_000132.3:c.1594T>G, NM_000132.3:c.1189_1190insC, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1596G>A, NM_000132.3:c.1618C>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1630G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1337G>C, NM_000132.3:c.1338delA, NM_000132.3:c.1348T>G, NM_000132.3:c.1357G>T, NM_000132.3:c.1390G>T, NM_000132.3:c.1595G>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1400T>G, NM_000132.3:c.1406G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.173delC, NM_000132.3:c.1752+5G>C, NM_000132.3:c.185C>G, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1913G>A, NM_000132.3:c.1924_1927delGATA, NM_000132.3:c.1934A>C, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1943_1946delTTTG, NM_000132.3:c.1952A>C, NM_000132.3:c.195C>A, NM_000132.3:c.1985G>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.199_200delAA, NM_000132.3:c.1992_1995dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1999delT, NM_000132.3:c.199A>G, NM_000132.3:c.1A>G, NM_000132.3:c.2009_2011delTCT, NM_000132.3:c.200A>C, NM_000132.3:c.201G>T, NM_000132.3:c.202_203insGA, NM_000132.3:c.202_207delACTCTG, NM_000132.3:c.2029T>C, NM_000132.3:c.2032A>T, NM_000132.3:c.203C>A, NM_000132.3:c.2057C>G, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2060T>C, NM_000132.3:c.2066T>G, NM_000132.3:c.1394C>G, NM_000132.3:c.1397G>A, NM_000132.3:c.2077_2078delTCinsCT, NM_000132.3:c.2088_2089delTG, NM_000132.3:c.2090T>A, NM_000132.3:c.2095A>C, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>T, NM_000132.3:c.1086G>A, NM_000132.3:c.2097G>A, NM_000132.3:c.1164delC, NM_000132.3:c.1172G>C, NM_000132.3:c.214G>A, NM_000132.3:c.217T>C, NM_000132.3:c.1187A>T, NM_000132.3:c.224delA, NM_000132.3:c.225T>A, NM_000132.3:c.1202G>A, NM_000132.3:c.2338delA, NM_000132.3:c.2360delA, NM_000132.3:c.2372dupG, NM_000132.3:c.2374delT, NM_000132.3:c.2383A>G, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2397delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2409delT, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2462_2463delGG, NM_000132.3:c.250_255delAGGCCA, NM_000132.3:c.250A>G, NM_000132.3:c.253_255delCCA, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.3031A>T, NM_000132.3:c.3034G>C, NM_000132.3:c.3053delA, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3152delT, NM_000132.3:c.3168_3187delTGAGTTTAAAAAAGTGACAC, NM_000132.3:c.3196C>T, NM_000132.3:c.3202_3203delAG, NM_000132.3:c.3224delC, NM_000132.3:c.3251C>G, NM_000132.3:c.3255_3258delTAAA, NM_000132.3:c.3279G>A, NM_000132.3:c.3289C>T, NM_000132.3:c.3295delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3344delT, NM_000132.3:c.3371C>A, NM_000132.3:c.144-26A>T, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1443+2T>C, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3417dupT, NM_000132.3:c.3421C>T, NM_000132.3:c.3490delT, NM_000132.3:c.3493G>T, NM_000132.3:c.3496A>T, NM_000132.3:c.3500dupA, NM_000132.3:c.3505delG, NM_000132.3:c.3540delA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3565dupA, NM_000132.3:c.3607G>T, NM_000132.3:c.3624delT, NM_000132.3:c.3631A>T, NM_000132.3:c.3651delA, NM_000132.3:c.3652delG, NM_000132.3:c.3710delC, NM_000132.3:c.3721_3739del19ins6, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3756delG, NM_000132.3:c.3766G>T, NM_000132.3:c.3771delT, NM_000132.3:c.3827C>G, NM_000132.3:c.3830delC, NM_000132.3:c.3833delA, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3844A>T, NM_000132.3:c.3847_3848delCA, NM_000132.3:c.3858delT, NM_000132.3:c.3860delT, NM_000132.3:c.3863dupC, NM_000132.3:c.3870dupA, NM_000132.3:c.3886delT, NM_000132.3:c.3902delA, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3913C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3940A>C, NM_000132.3:c.3964C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3982C>T, NM_000132.3:c.3984dupA, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.4006C>T, NM_000132.3:c.4034delA, NM_000132.3:c.403G>A, NM_000132.3:c.4045delA, NM_000132.3:c.404A>G, NM_000132.3:c.405T>A, NM_000132.3:c.4072C>T, NM_000132.3:c.407A>C, NM_000132.3:c.4093_4099delCATTTGA, NM_000132.3:c.4100delC, NM_000132.3:c.4113_4153dup41, NM_000132.3:c.4156C>T, NM_000132.3:c.415C>T, NM_000132.3:c.4197delC, NM_000132.3:c.4201C>T, NM_000132.3:c.421G>T, NM_000132.3:c.4241C>A, NM_000132.3:c.4242dupA, NM_000132.3:c.4264_4265delTA, NM_000132.3:c.2071C>A, NM_000132.3:c.2072C>T, NM_000132.3:c.4293_4297delCTCTT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.430G>T, NM_000132.3:c.4318delT, NM_000132.3:c.4336delG, NM_000132.3:c.4339dupG, NM_000132.3:c.2096T>A, NM_000132.3:c.4345delG, NM_000132.3:c.209T>C, NM_000132.3:c.2101_2105delATGGA, NM_000132.3:c.4363C>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.223G>T, NM_000132.3:c.4408G>T, NM_000132.3:c.440T>A, NM_000132.3:c.230T>C, NM_000132.3:c.4424_4425delAA, NM_000132.3:c.4426_4427delAG, NM_000132.3:c.4429_4430delGA, NM_000132.3:c.4446dupG, NM_000132.3:c.4450delA, NM_000132.3:c.4458delA, NM_000132.3:c.446delC, NM_000132.3:c.4473C>A, NM_000132.3:c.4473C>G, NM_000132.3:c.4474A>T, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4491_4492delTG, NM_000132.3:c.4491_4495delTGTTC, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492delG, NM_000132.3:c.4512_4513ins32, NM_000132.3:c.4512delG, NM_000132.3:c.4513_4515delCCCinsGCAAAGTTGGTTTGCCAAAACCATGTTGCCG, NM_000132.3:c.4519delA, NM_000132.3:c.4531G>A, NM_000132.3:c.4542delT, NM_000132.3:c.4543_4544delCCinsA, NM_000132.3:c.4549_4550delGT, NM_000132.3:c.4561C>T, NM_000132.3:c.4619delT, NM_000132.3:c.4658delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4665_4688del24insAAGGAA, NM_000132.3:c.4672_4675delAACA, NM_000132.3:c.4683delA, NM_000132.3:c.4687delG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4697_4701dupTGAGA, NM_000132.3:c.4710_4713delAGAA, NM_000132.3:c.3385delC, NM_000132.3:c.3388delA, NM_000132.3:c.3402delG, NM_000132.3:c.472C>T, NM_000132.3:c.476T>C, NM_000132.3:c.4770T>A, NM_000132.3:c.4794G>T, NM_000132.3:c.4798A>T, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4805delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4825delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4841delA, NM_000132.3:c.4848delC, NM_000132.3:c.4856delC, NM_000132.3:c.4858delC, NM_000132.3:c.4864G>A, NM_000132.3:c.4895delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4899delT, NM_000132.3:c.489T>A, NM_000132.3:c.4918G>T, NM_000132.3:c.4922dupT, NM_000132.3:c.4925A>G, NM_000132.3:c.4926delA, NM_000132.3:c.4934G>A, NM_000132.3:c.4935G>A, NM_000132.3:c.493C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4996C>T, NM_000132.3:c.4999delC, NM_000132.3:c.5010delT, NM_000132.3:c.5012G>A, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.514T>C, NM_000132.3:c.515G>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5226_5227delGA, NM_000132.3:c.5243delA, NM_000132.3:c.5251A>T, NM_000132.3:c.5254delG, NM_000132.3:c.525C>A, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5291A>G, NM_000132.3:c.5301C>A, NM_000132.3:c.5308G>A, NM_000132.3:c.5321A>T, NM_000132.3:c.532C>G, NM_000132.3:c.5330T>C, NM_000132.3:c.5337delG, NM_000132.3:c.5339C>T, NM_000132.3:c.5343T>A, NM_000132.3:c.5345T>G, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.535T>C, NM_000132.3:c.545A>T, NM_000132.3:c.553A>G, NM_000132.3:c.556G>A, NM_000132.3:c.557_559delACT, NM_000132.3:c.557A>G, NM_000132.3:c.560T>A, NM_000132.3:c.566C>A, NM_000132.3:c.5674G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5680G>A, NM_000132.3:c.5686G>C, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5696dupT, NM_000132.3:c.5697delC, NM_000132.3:c.5712G>C, NM_000132.3:c.5718dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.571C>T, NM_000132.3:c.5721C>G, NM_000132.3:c.5722_5723delTGinsTCATCAAAGTACTTCAAAAA, NM_000132.3:c.5752delT, NM_000132.3:c.5766C>A, NM_000132.3:c.577G>A, NM_000132.3:c.5816-14delGTinsTA, NM_000132.3:c.5816C>A, NM_000132.3:c.5816C>T, NM_000132.3:c.5825G>T, NM_000132.3:c.5833A>G, NM_000132.3:c.5853A>C, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5869C>T, NM_000132.3:c.5879G>T, NM_000132.3:c.5881T>A, NM_000132.3:c.5884T>G, NM_000132.3:c.5888T>C, NM_000132.3:c.5891T>C, NM_000132.3:c.5894G>T, NM_000132.3:c.589_591delGTA, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5934T>G, NM_000132.3:c.5939A>C, NM_000132.3:c.5953delC, NM_000132.3:c.5954G>C, NM_000132.3:c.5955_5956delAA, NM_000132.3:c.5955delA, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5999G>C, NM_000132.3:c.6016G>T, NM_000132.3:c.6037G>A, NM_000132.3:c.6046C>G, NM_000132.3:c.6070dupC, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6082delG, NM_000132.3:c.6089dupG, NM_000132.3:c.6094C>T, NM_000132.3:c.6099delT, NM_000132.3:c.6107A>G, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6116_6117delAG, NM_000132.3:c.6120_6135delTCAGACTCCCCTGGGA, NM_000132.3:c.6120T>A, NM_000132.3:c.6127delC, NM_000132.3:c.6134G>T, NM_000132.3:c.6135dupA, NM_000132.3:c.6194G>A, NM_000132.3:c.6202_6257dup56, NM_000132.3:c.6213A>T, NM_000132.3:c.6239C>T, NM_000132.3:c.6242G>C, NM_000132.3:c.6243G>C, NM_000132.3:c.6250A>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6263C>T, NM_000132.3:c.6269T>A, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6449A>T, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6467_6468delAC, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6473delT, NM_000132.3:c.6482C>A, NM_000132.3:c.6482C>T, NM_000132.3:c.6488T>G, NM_000132.3:c.6489delT, NM_000132.3:c.6494delC, NM_000132.3:c.6497delG, NM_000132.3:c.6501delC, NM_000132.3:c.6515C>G, NM_000132.3:c.6517_6519dupACT, NM_000132.3:c.6520C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6537C>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6548T>G, NM_000132.3:c.6551A>T, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+5G>C, NM_000132.3:c.65G>C, NM_000132.3:c.6738delA, NM_000132.3:c.6739_6740delGA, NM_000132.3:c.6739G>T, NM_000132.3:c.6743G>C, NM_000132.3:c.6746T>G, NM_000132.3:c.6752T>A, NM_000132.3:c.6760C>T, NM_000132.3:c.6760delC, NM_000132.3:c.676A>T, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6796G>A, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6804delA, NM_000132.3:c.680G>A, NM_000132.3:c.6825T>A, NM_000132.3:c.6827T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6839T>C, NM_000132.3:c.6842T>C, NM_000132.3:c.684_685delCT, NM_000132.3:c.6856_6866delGATGGCCATCA, NM_000132.3:c.6865C>T, NM_000132.3:c.6869G>T, NM_000132.3:c.6870G>A, NM_000132.3:c.687_688delAG, NM_000132.3:c.6886delA, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6904T>G, NM_000132.3:c.6905T>C, NM_000132.3:c.6912_6916delAAATC, NM_000132.3:c.6915delT, NM_000132.3:c.6919_6920delGA, NM_000132.3:c.6921delC, NM_000132.3:c.693_696delAAAG, NM_000132.3:c.6969_6977delCTACCTTCG, NM_000132.3:c.6976C>G, NM_000132.3:c.6986C>T, NM_000132.3:c.6988delC, NM_000132.3:c.6995G>C, NM_000132.3:c.6996G>A, NM_000132.3:c.6997delG, NM_000132.3:c.7012delC, NM_000132.3:c.7016G>T, NM_000132.3:c.7021G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7031G>A, NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.709C>T, NM_000132.3:c.729delT, NM_000132.3:c.73delT, NM_000132.3:c.755C>A, NM_000132.3:c.760A>T, NM_000132.3:c.764G>A, NM_000132.3:c.770_771insCC, NM_000132.3:c.775A>T, NM_000132.3:c.779C>G, NM_000132.3:c.77T>C, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-2A>T, NM_000132.3:c.796G>T, NM_000132.3:c.820T>C, NM_000132.3:c.822G>A, NM_000132.3:c.824A>G, NM_000132.3:c.832G>A, NM_000132.3:c.836T>A, NM_000132.3:c.849delT, NM_000132.3:c.850G>A, NM_000132.3:c.850G>T, NM_000132.3:c.86T>G, NM_000132.3:c.871G>T, NM_000132.3:c.872A>G, NM_000132.3:c.883T>C, NM_000132.3:c.886C>T, NM_000132.3:c.889delG, NM_000132.3:c.88G>A, NM_000132.3:c.899A>C, NM_000132.3:c.899A>T, NM_000132.3:c.902G>C, NM_000132.3:c.906delG, NM_000132.3:c.912C>T, NM_000132.3:c.918delA, NM_000132.3:c.920T>G, NM_000132.3:c.935delT, NM_000132.3:c.941C>T, NM_000132.3:c.943delG, NM_000132.3:c.948_951delAACA, NM_000132.3:c.967G>A, NM_000132.3:c.974_975delTT, NM_000132.3:c.97T>G, NM_000132.3:c.984delT, NM_000132.3:c.985dupT, NM_000132.3:c.986G>A, NM_000132.3:c.986G>C, NM_000132.3:c.986G>T, NM_000132.3:c.98G>A, NM_000132.3:c.1726G>T, NM_000132.3:c.4345G>T, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.439_447dupGTCTTCCCT, NM_000132.3:c.4720delG, NM_000132.3:c.1661G>A, NM_000132.3:c.4423C>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1640G>A, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1667T>A, NM_000132.3:c.4272delC, NM_000132.3:c.1653T>G, NM_000132.3:c.471G>A, NM_000132.3:c.1688C>G, NM_000132.3:c.4280delT, NM_000132.3:c.1675G>T600
F8Hemofilia A-Inv22 (Detección por PCR)600
F9Hemofilia BNM_000133.3NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>T250,600
FAHTirosinemia tipo 1NM_000137.2NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>T250,600
FAM126AHipomielinización - catarata congénitaNM_032581.3NM_032581.3:c.191A>G, NM_032581.3:c.158T>C600
FAM20CDisplasia osteosclerótica de huesoNM_020223.3NM_020223.3:c.1093G>C, NM_020223.3:c.773T>A, NM_020223.3:c.1364-5C>T, NM_020223.3:c.1163T>G, NM_020223.3:c.838G>A, NM_020223.3:c.1351G>A600
FANCAAnemia de Fanconi grupo de complementación ANM_000135.2NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insA250,600
FANCCAnemia de Fanconi grupo de complementación CNM_000136.2NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG250,600
FANCD2Anemia de Fanconi grupo de complementación D2NM_033084.3NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>T250,600
FANCEAnemia de Fanconi grupo de complementación ENM_021922.2NM_021922.2:c.1501C>T, NM_021922.2:c.929_930insC, NM_021922.2:c.421C>T, NM_021922.2:c.1114-8G>A, NM_021922.2:c.922_923insC, NM_021922.2:c.355C>T600
FANCGAnemia de Fanconi, grupo de complementación GNM_004629.1NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCT250,600
FANCIAnemia de Fanconi grupo de complementación INM_001113378.1NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>A250,600
FANCLAnemia de Fanconi grupo de complementación LNM_018062.3NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTA250,600
FANCMAnemia de Fanconi grupo de complementación MNM_020937.2NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGA250,600
FGADéficit congénito de fibrinógeno (gen FGA)NM_021871.2NM_021871.2:c.1039C>T, NM_021871.2:c.1441delG, NM_021871.2:c.*675_*676insC, NM_021871.2:c.1359dupC, NM_021871.2:c.*1086delG, NM_021871.2:c.1906_1907insC600
FGBAfibrinogenemia familiarNM_005141.4NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>T250,600
FGD4Enfermedad de Charcot-Marie-Tooth tipo 4HNM_139241.2NM_139241.2:c.1325G>A, NM_139241.2:c.893T>G, NM_139241.2:c.893T>C, NM_139241.2:c.670C>T600
FHAciduria fumáricaNM_000143.3NM_000143.3:c.1067T>A, NM_000143.3:c.697C>T, NM_000143.3:c.698G>A, NM_000143.3:c.1236+1G>C, NM_000143.3:c.901dupA, NM_000143.3:c.320A>C, NM_000143.3:c.760C>T, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.521C>G, NM_000143.3:c.1093A>G, NM_000143.3:c.1189G>A, NM_000143.3:c.1200delT, NM_000143.3:c.1394A>G, NM_000143.3:c.1255T>C, NM_000143.3:c.793G>A, NM_000143.3:c.40_41insC, NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1293delA600
FHL1Distrofia muscular de Emery-Dreifuss tipo 6NM_001449.4NM_001449.4:c.625T>C600
FHL1Miopatía con inclusiones reductorasNM_001449.4NM_001449.4:c.689-479G>A, NM_001449.4:c.310T>C600
FIG4Enfermedad de Charcot-Marie-Tooth tipo 4JNM_014845.5NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insG250,600
FIG4Síndrome de Yunis-VaronNM_014845.5NM_014845.5:c.311G>A250,600
FKRPDistrofia muscular congénita tipo 5BNM_024301.4NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>A250,600
FKRPDistrofia muscular de cinturas autosómica recesiva tipo 2lNM_024301.4NM_024301.4:c.160C>T250,600
FKTNDistrofia muscular congénita tipo FukuyamaNM_001079802.1NM_001079802.1:c.1112A>G, NM_001079802.1:c.509C>A, NM_001079802.1:c.411C>A, NM_001079802.1:c.1167dupA600
FKTNDistrofia muscular de cinturas tipo 2MNM_001079802.1NM_001079802.1:c.1380dupA, NM_001079802.1:c.766C>T, NM_001079802.1:c.527T>C, NM_001079802.1:c.340G>A600
FLNADisplasia frontometafisariaNM_001456.3NM_001456.3:c.4447_4448insAT, NM_001456.3:c.760G>A, NM_001456.3:c.3476A>C, NM_001456.3:c.3557C>T600
FLNAHeterotopia periventricularNM_001456.3NM_001456.3:c.4543C>T, NM_001456.3:c.7129C>T, NM_001456.3:c.7733-1G>C, NM_001456.3:c.7527_7528+6delAGGTGAGC, NM_001456.3:c.5108_5109delTCinsAA, NM_001456.3:c.2761C>T, NM_001456.3:c.4777_4778dupAA600
FLVCR1Enfermedad de astas posteriores, ataxia - Retinosis pigmentariaNM_014053.3NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delA600
FMR1Síndrome de X-frágil-(CGG)n pre-mutated allele (Detección por PCR y TP-PCR)250,600
FOXN1Inmunodeficiencia severa de linfocitos T - alopecia congénita - distrofia unguealNM_003593.2NM_003593.2:c.763C>T600
FRAS1Síndrome de FraserNM_025074.6NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insT250,600
FREM2Síndrome de FraserNM_207361.5NM_207361.5:c.2361_2362insC, NM_207361.5:c.8409+1G>A, NM_207361.5:c.5914G>A, NM_207361.5:c.5920G>A, NM_207361.5:c.3792_3795delTTAT600
FUCA1FucosidosisNM_000147.4NM_000147.4:c.244C>T, NM_000147.4:c.1279C>T, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.1229T>G, NM_000147.4:c.433T>C600
FXNAtaxia de FriedreichNM_000144.4NM_000144.4:c.389G>T, NM_000144.4:c.460A>T, NM_000144.4:c.385-2A>G, NM_000144.4:c.317T>G600
G6PCEnfermedad de almacenamiento de glucógeno tipo 1aNM_000151.3NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>A250,600
G6PC3Neutropenia congénita grave tipo 4NM_138387.3NM_138387.3:c.346A>G, NM_138387.3:c.141C>G, NM_138387.3:c.778G>C, NM_138387.3:c.758G>A, NM_138387.3:c.935_936insT, NM_138387.3:c.784G>C600
GAAEnfermedad de almacenamiento de glucógeno tipo 2NM_000152.3NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delA250,600
GALCEnfermedad de KrabbeNM_000153.3NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>C250,600
GALTGalactosemiaNM_000155.3NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAG250,600
GAMTDéficit de guanidinoacetato metiltransferasaNM_000156.5NM_000156.5:c.506G>A, NM_000156.5:c.590T>C600
GANNeuropatía axonal giganteNM_022041.3NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>C250,600
GBAEnfermedad de GaucherNM_001005741.2NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>T250,600
GBE1Enfermedad de almacenamiento de glucógeno tipo 4NM_000158.3NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>G250,600
GBE1Enfermedad con cuerpos de poliglucosano, adultoNM_000158.3NM_000158.3:c.986A>G250,600
GCDHAcidemia glutárica tipo 1NM_000159.3NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>T250,600
GCSHEncefalopatía por glicina (GCSH)NM_004483.4NM_004483.4:c.337dupT600
GDAP1Enfermedad de Charcot-Marie-Tooth tipo 4ANM_018972.2NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.311-1G>A, NM_018972.2:c.844C>T, NM_018972.2:c.715C>T, NM_018972.2:c.92G>A600
GFM1Déficit combinado de la fosforilación oxidativa tipo 1NM_024996.5NM_024996.5:c.1294_1297delACAG, NM_024996.5:c.748C>T, NM_024996.5:c.139C>T, NM_024996.5:c.1528_1529delAG, NM_024996.5:c.521A>G600
GJA1Displasia oculodentodigitalNM_000165.4NM_000165.4:c.227G>A, NM_000165.4:c.97C>T600
GJB2Sordera tipo 1A autosómica recesivaNM_004004.5NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>T250,600
GJB3Sordera tipo 1A autosómica recesivaNM_024009.2NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>T250,600
GJB6Sordera tipo 1B autosómica recesivaNM_006783.4NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insA250,600
GJC2Enfermedad tipo Pelizaeus-Merzbacher tipo 1NM_020435.3NM_020435.3:c.857T>C, NM_020435.3:c.814T>G, NM_020435.3:c.613C>T, NM_020435.3:c.787G>A, NM_020435.3:c.718C>T, NM_020435.3:c.268C>T600
GLB1Gangliosidosis GM1NM_000404.2NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>T250,600
GLB1Mucopolisacaridosis tipo 4BNM_000404.2NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>C250,600
GLDCEncefalopatía por glicinaNM_000170.2NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>T250,600
GLE1Artrogriposis letal con alteración celular de las astas medulares anterioresNM_001003722.1NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>T250,600
GM2AGangliosidosis GM2NM_000405.4NM_000405.4:c.285delC, NM_000405.4:c.160G>T, NM_000405.4:c.506G>C600
GNEMiopatía distal tipo NonakaNM_005476.5NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>A250,600
GNPTABMucolipidosis tipo 2/tipo3NM_024312.4NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAG250,600
GNSMucopolisacaridosis tipo 3DNM_002076.3NM_002076.3:c.1063C>T, NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.413C>G600
GPR143Albinismo ocular ligado al XNM_000273.2NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>A600
GPR179Ceguera nocturna estacionaria congénita tipo 1ENM_001004334.3NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAG250,600
GPR98Síndrome de Usher tipo 2CNM_032119.3NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insT250,600
GRHPRHiperoxaluria primaria tipo 2NM_012203.1NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.755dupA, NM_012203.1:c.622C>T, NM_012203.1:c.435G>A600
GRM6Ceguera nocturna estacionaria congénita tipo 1BNM_000843.3NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>A250,600
GRXCR1Sordera tipo 25 autosómica recesivaNM_001080476.2NM_001080476.2:c.229C>T, NM_001080476.2:c.190G>A, NM_001080476.2:c.710_711delAT600
GSSDéficit de glutatión sintetasaNM_000178.2NM_000178.2:c.656A>G, NM_000178.2:c.847C>T, NM_000178.2:c.754C>T, NM_000178.2:c.799C>T, NM_000178.2:c.4delG, NM_000178.2:c.656A>C, NM_000178.2:c.491G>A, NM_000178.2:c.832C>T600
GUCY2DAmaurosis congénita de Leber tipo 1NM_000180.3NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.2734_2735delTT, NM_000180.3:c.2945delG600
GUSBMucopolisacaridosis tipo 7NM_000181.3NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>A250,600
HADHADéficit de proteina trifuncional mitocondrialNM_000182.4NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupT250,600
HADHBDéficit de proteina trifuncional mitocondrialNM_000183.2NM_000183.2:c.788A>G, NM_000183.2:c.1364T>G, NM_000183.2:c.1331G>A600
HALHistidinemiaNM_002108.3NM_002108.3:c.890_891insT, NM_002108.3:c.146_152delATGACGC, NM_002108.3:c.1287+2T>C, NM_002108.3:c.102_103insGC, NM_002108.3:c.903+1G>A600
HBAAlfa talasemia---MED, --SEA, --THAI, -?4.2, -?3.7, --FIL, -(?)20.5 (Detección por PCR)600
HBBBeta-talasemiaNM_000518.4NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>A250,600
HBBAnemia falciformeNM_000518.4NM_000518.4:c.19G>A, NM_000518.4:c.20A>T250,600
HESX1Déficit combinado de hormonas hipofisarias de causa genéticaNM_003865.2NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>C250,600
HEXAEnfermedad de Tay-SachsNM_000520.4NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTAT250,600
HEXBEnfermedad de SandhoffNM_000521.3NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>T250,600
HFEHemocromatosisNM_000410.3NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>C250,600
HGDAlcaptonuriaNM_000187.3NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>A250,600
HGFSordera tipo 39 autosómico recesivaNM_000601.4NM_000601.4:c.2028delA, NM_000601.4:c.1597C>T600
HGSNATMucopolisacaridosis tipo 3CNM_152419.2NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>A250,600
HIBCHDéficit de 3-hidroxisobutiril-CoA-hidrolasaNM_014362.3NM_014362.3:c.1012A>T, NM_014362.3:c.79-3C>G, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G600
HMGCLAciduria 3-hidroxi-3-metil-glutáricaNM_000191.2NM_000191.2:c.835G>A, NM_000191.2:c.230delT, NM_000191.2:c.122G>A, NM_000191.2:c.698A>G, NM_000191.2:c.206_207delCT, NM_000191.2:c.505_506delTC600
HPDTirosinemia tipo 3NM_002150.2NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delA250,600
HPRT1Síndrome de Lesch-NyhanNM_000194.2NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.610-2A>G, NM_000194.2:c.532+2T>G600
HPS1Síndrome de Hermansky-Pudlak tipo 1NM_000195.3NM_000195.3:c.972_973insC, NM_000195.3:c.972delC, NM_000195.3:c.1996G>T, NM_000195.3:c.398+5G>A, NM_000195.3:c.1472_1487dupCCAGCAGGGGAGGCCC, NM_000195.3:c.397G>T600
HSD17B4Déficit de proteína D bifuncionalNM_000414.3NM_000414.3:c.1369A>T, NM_000414.3:c.46G>A, NM_000414.3:c.972+1G>T, NM_000414.3:c.317G>C600
HSD17B4Síndrome PerraultNM_000414.3NM_000414.3:c.650A>G600
HSPD1Leucodistrofia hipomielinizante tipo 4NM_002156.4NM_002156.4:c.292G>A600
HSPG2Síndrome de Schwartz-Jampel tipo 1NM_005529.6NM_005529.6:c.13075delC, NM_005529.6:c.1653_1654insT, NM_005529.6:c.10355G>A, NM_005529.6:c.1125C>A, NM_005529.6:c.9326delA, NM_005529.6:c.8464+4A>G600
HTRA1Síndrome CARASILNM_002775.4NM_002775.4:c.1108C>T, NM_002775.4:c.883G>A, NM_002775.4:c.904C>T, NM_002775.4:c.754G>A, NM_002775.4:c.889G>A600
HYLS1Síndrome hidroletalus tipo 1NM_145014.2NM_145014.2:c.632A>G, NM_145014.2:c.724C>T, NM_145014.2:c.669G>A600
IDH3BRetinosis pigmentaria tipo 46NM_006899.3NM_006899.3:c.395T>C, NM_006899.3:c.490C>T, NM_006899.3:c.589delA600
IDSMucopolisacaridosis tipo 2NM_000202.6NM_000202.6:c.1464G>T, NM_000202.6:c.1466G>C, NM_000202.6:c.1505G>C, NM_000202.6:c.283A>G, NM_000202.6:c.208dupC, NM_000202.6:c.596_599delAACA, NM_000202.6:c.597delA, NM_000202.6:c.683C>T, NM_000202.6:c.1148delC, NM_000202.6:c.880-8A>G, NM_000202.6:c.937C>T, NM_000202.6:c.998C>T, NM_000202.6:c.690_691insT, NM_000202.6:c.1122C>T, NM_000202.6:c.587T>C, NM_000202.6:c.314_317dupTCAA, NM_000202.6:c.278delC, NM_000202.6:c.514C>T, NM_000202.6:c.1508T>A, NM_000202.6:c.388_389insG, NM_000202.6:c.240+1G>A, NM_000202.6:c.404A>G600
IFT80Displasia torácica con costillas cortas tipo 2 con o sin polidactiliaNM_020800.2NM_020800.2:c.701C>G, NM_020800.2:c.721G>C, NM_020800.2:c.315C>G600
IGF1Retraso en el crecimiento por déficit en el factor de crecimiento insulínico tipo 1NM_000618.3NM_000618.3:c.274G>A600
IGHMBP2Atrofia muscular espinal distal tipo 1 autosómica recesivaNM_002180.2NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>G250,600
IKBKAPDisautonomía familiarNM_003640.3NM_003640.3:c.3332delC, NM_003640.3:c.1460+2T>C, NM_003640.3:c.2204+6T>C, NM_003640.3:c.2328delT, NM_003640.3:c.2741C>T, NM_003640.3:c.2087G>C, NM_003640.3:c.2087G>A600
IL2RGInmunodeficiencia combinada grave T-B+ ligada al XNM_000206.2NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.186T>A, NM_000206.2:c.664C>T, NM_000206.2:c.343T>C, NM_000206.2:c.854G>A, NM_000206.2:c.341G>A, NM_000206.2:c.355A>T600
IMPDH1Retinosis pigmentaria tipo 10NM_000883.3NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>A250,600
IMPG2Retinosis pigmentaria tipo 56NM_016247.3NM_016247.3:c.635C>G, NM_016247.3:c.3262C>T, NM_016247.3:c.502-1G>C, NM_016247.3:c.2890C>T600
INPP5ESíndrome de Joubert tipo 1NM_019892.4NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>A250,600
INPP5ESíndrome MORMNM_019892.4NM_019892.4:c.1879C>T250,600
INSRDiabetes mellitus, resistencia a insulinaNM_000208.2NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>G250,600
INSRLeprechaunismoNM_000208.2NM_000208.2:c.2668C>T, NM_000208.2:c.172G>A250,600
IQCB1Síndrome de Senior-Loken tipo 5NM_001023570.2NM_001023570.2:c.1036G>T, NM_001023570.2:c.817G>T, NM_001023570.2:c.1381C>T, NM_001023570.2:c.1465C>T, NM_001023570.2:c.1090C>T, NM_001023570.2:c.1518_1519delCA, NM_001023570.2:c.1069C>T600
ISCUMiopatía por déficit de ISCUNM_213595.3NM_213595.3:c.338_339+2delCGGT, NM_213595.3:c.149G>A600
ITGA6Epidermólisis bullosa juntural con atresia pilóricaNM_000210.2NM_000210.2:c.791delC, NM_000210.2:c.1255dupA600
ITGB4Epidermólisis bullosa juntural con atresia pilóricaNM_001005731.1NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>A250,600
ITGB4Epidermólisis bullosa juntural sin atresia pilóricaNM_001005731.1NM_001005731.1:c.2792G>A250,600
IVDAcidemia isovaléricaNM_002225.3NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGT250,600
JAK3Inmunodeficiencia combinada grave T-B+NK-NM_000215.3NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>A250,600
KCNJ1Síndrome de Bartter tipo 2NM_000220.4NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G250,600
KCNJ13Amaurosis congénita de Leber tipo 16NM_002242.4NM_002242.4:c.722T>C600
KCNV2Distrofia de conos de retina tipo 3BNM_133497.3NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>T250,600
KIF7Síndrome acrocallosoNM_198525.2NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.3001C>T, NM_198525.2:c.460C>T, NM_198525.2:c.61C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.3778_3779insC600
L1CAMSíndrome de MASA/hidrocefaliaNM_000425.4NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.719C>T, NM_000425.4:c.3581C>T, NM_000425.4:c.2879delA, NM_000425.4:c.791G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.924C>T, NM_000425.4:c.536T>G, NM_000425.4:c.23delT, NM_000425.4:c.2254G>A, NM_000425.4:c.800dupA, NM_000425.4:c.772C>T, NM_000425.4:c.1354G>A, NM_000425.4:c.551G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1108G>A600
LAMA2Distrofia muscular congénita tipo 1ANM_000426.3NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>A250,600
LAMA3Epidermólisis bullosa junturalNM_000227.3NM_000227.3:c.-122061G>T, NM_000227.3:c.335delG, NM_000227.3:c.4878dupT, NM_000227.3:c.2116A>T, NM_000227.3:c.4135C>T, NM_000227.3:c.751G>T, NM_000227.3:c.1981C>T, NM_000227.3:c.3350+2T>G, NM_000227.3:c.1182delG, NM_000227.3:c.4335_4336insA, NM_000227.3:c.2662C>T600
LAMB3Epidermólisis bullosa junturalNM_000228.2NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>T250,600
LAMC2Epidermólisis bullosa junturalNM_005562.2NM_005562.2:c.1659C>A, NM_005562.2:c.3069+1G>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.3512_3513insA, NM_005562.2:c.405-1G>A, NM_005562.2:c.3120_3121insA600
LARGEDistrofia-distroglicanopatia muscular tipo 6NM_004737.4NM_004737.4:c.1102C>T, NM_004737.4:c.992C>T, NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>C600
LBRDisplasia esquelética de GreenbergNM_002296.3NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGT600
LDHAEnfermedad de almacenamiento de glucógeno tipo 11NM_005566.3NM_005566.3:c.126+1_126+4delGTAA, NM_005566.3:c.126+1G>A, NM_005566.3:c.126+1_126+4del, NM_005566.3:c.213+1_213+4delGTAA, NM_005566.3:c.640_641delCT600
LEPRE1Osteogénesis imperfecta tipo 8NM_022356.3NM_022356.3:c.2055+13_2055+31del19, NM_022356.3:c.1656C>A, NM_022356.3:c.1365_1366delAGinsC, NM_022356.3:c.2068_2086delCGAGCGGGTGAGAGCAGCT, NM_022356.3:c.747delC, NM_022356.3:c.1102C>T, NM_022356.3:c.1473+1G>T600
LHFPL5Sordera tipo 67 autosómica recesivaNM_182548.3NM_182548.3:c.494C>T, NM_182548.3:c.476G>A, NM_182548.3:c.649delG, NM_182548.3:c.250delC, NM_182548.3:c.380A>G600
LHX3Déficit combinados de hormonas hipofisarias tipo 3NM_014564.3NM_014564.3:c.687G>A, NM_014564.3:c.347A>G600
LIFRSíndrome de Stuve-WiedemannNM_002310.5NM_002310.5:c.2013_2014insT, NM_002310.5:c.653dupT, NM_002310.5:c.1018_1022delAATTG, NM_002310.5:c.2503G>T, NM_002310.5:c.171_174delTAAC, NM_002310.5:c.1789C>T600
LIG4Síndrome de LIG4NM_002312.3NM_002312.3:c.1271_1275delAAAGA, NM_002312.3:c.833G>A, NM_002312.3:c.1738C>T, NM_002312.3:c.2440C>T, NM_002312.3:c.1406G>A, NM_002312.3:c.1455_1456delTG, NM_002312.3:c.1369_1372delGGAC, NM_002312.3:c.1512_1513delTC600
LMNACardiomiopatía dilatada tipo 1ANM_170707.3NM_170707.3:c.1366A>C, NM_170707.3:c.1930C>T, NM_170707.3:c.1567G>A, NM_170707.3:c.1786G>A250,600
LMNASíndrome Hutchinson-Gilford progeriaNM_170707.3NM_170707.3:c.1579C>T, NM_170707.3:c.1411C>T, NM_170707.3:c.1824C>T, NM_170707.3:c.1626G>C250,600
LMNALipodistrofia familiar parcial tipo 2NM_170707.3NM_170707.3:c.1318G>A250,600
LMNADisplasia mandibuloacralNM_170707.3NM_170707.3:c.1586C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1228C>T250,600
LMNADistrofia muscular de Emery-Dreifuss tipo 3NM_170707.3NM_170707.3:c.1072G>A, NM_170707.3:c.419T>C, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1583C>A250,600
LOXHD1Sordera tipo 77 autosómica recesivaNM_144612.6NM_144612.6:c.2008C>T, NM_144612.6:c.2T>A, NM_144612.6:c.3874C>T, NM_144612.6:c.4526G>A, NM_144612.6:c.3924C>A, NM_144612.6:c.512-1G>A, NM_144612.6:c.4524_4525delAG, NM_144612.6:c.4714C>T, NM_144612.6:c.457_461dupCGCCA600
LRATAmaurosis congénita de Leber type 14NM_004744.3NM_004744.3:c.217_218delAT, NM_004744.3:c.588dupT600
LRATDistrofia retiniana grave de aparición tempranaNM_004744.3NM_004744.3:c.525T>A600
LRP2Síndrome de Donnai-BarrowNM_004525.2NM_004525.2:c.11469_11472delTTTG, NM_004525.2:c.2640-1G>A, NM_004525.2:c.13139_13140insC, NM_004525.2:c.1093C>T, NM_004525.2:c.11663G>A, NM_004525.2:c.7564T>C, NM_004525.2:c.8519_8522delATTT, NM_004525.2:c.1341+2T>G, NM_004525.2:c.10769-2A>G, NM_004525.2:c.9484_9485delGT, NM_004525.2:c.13388+2T>C, NM_004525.2:c.11636-1G>T600
LRP5Vitreorretinopatía exudativa tipo 4NM_002335.3NM_002335.3:c.2254C>G, NM_002335.3:c.518C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.4099G>A250,600
LRP5Enfermedad poliquística hepática aisladaNM_002335.3NM_002335.3:c.4651G>A250,600
LRP5Síndrome de la osteoporosis - pseudogliomaNM_002335.3NM_002335.3:c.1481G>A, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.2305delG, NM_002335.3:c.2202G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.3107G>A, NM_002335.3:c.2557C>T250,600
LRPPRCSíndrome de Leigh tipo franco-canadienseNM_133259.3NM_133259.3:c.1061C>T, NM_133259.3:c.3830_3839delGTGGTGCAATinsAG600
LRTOMTSordera tipo 63 autosómica recesivaNM_001145308.4NM_001145308.4:c.242G>A600
MAKRetinosis pigmentaria tipo 62NM_001242957.1NM_001242957.1:c.37G>A, NM_001242957.1:c.719_720dupAG, NM_001242957.1:c.1087_1088delAG, NM_001242957.1:c.718C>T, NM_001242957.1:c.388A>C600
MAN2B1Alfa-manosidosisNM_000528.3NM_000528.3:c.215A>T, NM_000528.3:c.2401G>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2368C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1A>G, NM_000528.3:c.1067C>G, NM_000528.3:c.384G>A, NM_000528.3:c.2398G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.2426T>C, NM_000528.3:c.2436+2T>C, NM_000528.3:c.1259G>T, NM_000528.3:c.1780C>T, NM_000528.3:c.1929G>A, NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.1830+1G>C250,600
MARVELD2Sordera tipo 49 autosómica recesivaNM_001038603.2NM_001038603.2:c.1363C>T, NM_001038603.2:c.1183-1G>A600
MAT1ADéficit de metionina adenosiltransferasaNM_000429.2NM_000429.2:c.1006G>A, NM_000429.2:c.1070C>T, NM_000429.2:c.595C>T, NM_000429.2:c.1043_1044delTG, NM_000429.2:c.790C>T, NM_000429.2:c.827_828insG, NM_000429.2:c.538_539insTG, NM_000429.2:c.914T>C, NM_000429.2:c.791G>A, NM_000429.2:c.966T>G600
MATN3Displasia epifisaria múltiple tipo 5NM_002381.4NM_002381.4:c.1405+2T>C, NM_002381.4:c.910T>A, NM_002381.4:c.1303G>A, NM_002381.4:c.693G>C600
MBTPS2Ictiosis folicular - alopecia - fotofobiaNM_015884.3NM_015884.3:c.1286G>A, NM_015884.3:c.1424T>C, NM_015884.3:c.677G>T, NM_015884.3:c.261G>A600
MCCC1Déficit de 3-metilcrotonil-CoA carboxilasa tipo 1NM_020166.4NM_020166.4:c.1155A>C, NM_020166.4:c.1930G>T, NM_020166.4:c.2079delA, NM_020166.4:c.388G>A, NM_020166.4:c.559T>C, NM_020166.4:c.343C>T, NM_020166.4:c.640-2A>G, NM_020166.4:c.1942G>A, NM_020166.4:c.1905delA, NM_020166.4:c.640-1G>A, NM_020166.4:c.1074delG, NM_020166.4:c.1114C>T, NM_020166.4:c.558delA, NM_020166.4:c.1277T>C, NM_020166.4:c.1526delG, NM_020166.4:c.1380T>G, NM_020166.4:c.310C>T, NM_020166.4:c.1310T>C600
MCCC2Déficit de 3-metilcrotonil-CoA carboxilasa tipo 2NM_022132.4NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.1309A>G, NM_022132.4:c.515_516insT, NM_022132.4:c.1015G>A, NM_022132.4:c.464G>A, NM_022132.4:c.641delG, NM_022132.4:c.1576_1577insT, NM_022132.4:c.735_736insC, NM_022132.4:c.517_518insT, NM_022132.4:c.838G>T, NM_022132.4:c.499T>C, NM_022132.4:c.1367C>T, NM_022132.4:c.929C>G, NM_022132.4:c.1065A>T, NM_022132.4:c.1580G>A, NM_022132.4:c.994C>T, NM_022132.4:c.1072+1G>A250,600
MCEEAcidemia metilmalónica por déficit de metilmalonil-CoA epimerasaNM_032601.3NM_032601.3:c.178A>C, NM_032601.3:c.2T>C, NM_032601.3:c.139C>T600
MCOLN1Mucolipidosis tipo 4NM_020533.2NM_020533.2:c.1084G>T, NM_020533.2:c.304C>T, NM_020533.2:c.1207C>T, NM_020533.2:c.964C>T600
MCPH1Microcefalia primaria tipo 1 autosómica recesivaNM_024596.3NM_024596.3:c.1973+1G>A, NM_024596.3:c.2221C>T, NM_024596.3:c.427_428insA, NM_024596.3:c.1561G>T, NM_024596.3:c.1935+1G>T, NM_024596.3:c.215C>T, NM_024596.3:c.1249_1250insT600
MECP2Síndrome de RettNM_004992.3NM_004992.3:c.1048_1050delAGC, NM_004992.3:c.215dupC, NM_004992.3:c.611C>G, NM_004992.3:c.1282G>A, NM_004992.3:c.916C>T, NM_004992.3:c.806delG, NM_004992.3:c.502C>T, NM_004992.3:c.880C>T, NM_004992.3:c.674C>T, NM_004992.3:c.964C>T, NM_004992.3:c.705G>A, NM_004992.3:c.808C>T, NM_004992.3:c.730C>T, NM_004992.3:c.683C>G, NM_004992.3:c.753delC, NM_004992.3:c.965C>T, NM_004992.3:c.763C>T600
MED12Síndrome de OhdoNM_005120.2NM_005120.2:c.3493T>C, NM_005120.2:c.5185C>A, NM_005120.2:c.3443G>A600
MED25Enfermedad de Charcot-Marie-Tooth tipo 2B2NM_030973.3NM_030973.3:c.316delG, NM_030973.3:c.1366C>T, NM_030973.3:c.1004C>T250,600
MEFVFiebre mediterránea familiarNM_000243.2NM_000243.2:c.163_164insA, NM_000243.2:c.1437C>G, NM_000243.2:c.2282G>A, NM_000243.2:c.163dupA, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.1958G>A, NM_000243.2:c.443A>T, NM_000243.2:c.656_657insG, NM_000243.2:c.688G>A, NM_000243.2:c.800C>T, NM_000243.2:c.1223G>A, NM_000243.2:c.501G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.2040G>C, NM_000243.2:c.2084A>G, NM_000243.2:c.1141C>T, NM_000243.2:c.1016C>T, NM_000243.2:c.2177T>C, NM_000243.2:c.1772T>C, NM_000243.2:c.2080A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2230G>T250,600
MERTKRetinosis pigmentaria tipo 38NM_006343.2NM_006343.2:c.2189+1G>T, NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2784_2785insTA, NM_006343.2:c.2785_2786dupTA, NM_006343.2:c.2323C>T, NM_006343.2:c.2207_2210delCTGT250,600
MFRPMicroftalmia - Retinosis pigmentaria - foveosquisis - drusen de disco ópticoNM_031433.3NM_031433.3:c.498delC, NM_031433.3:c.523C>T, NM_031433.3:c.629G>T, NM_031433.3:c.1150_1151insC, NM_031433.3:c.545T>C, NM_031433.3:c.1124+1G>T250,600
MFSD8Lipofuscinosis neuronal ceroide tipo 7NM_152778.2NM_152778.2:c.1286G>A, NM_152778.2:c.999-2A>G, NM_152778.2:c.1235C>T, NM_152778.2:c.1090delA, NM_152778.2:c.362A>G, NM_152778.2:c.881C>A, NM_152778.2:c.929G>A, NM_152778.2:c.1525_1526delCT, NM_152778.2:c.894T>G600
MGAT2Trastorno congénito de la glicosilación tipo 2aNM_002408.3NM_002408.3:c.869C>T, NM_002408.3:c.785A>G, NM_002408.3:c.1017T>A600
MKKSSíndrome de Bardet-Biedl/McKusick-KaufmanNM_018848.3NM_018848.3:c.353delG250,600
MKKSSíndrome de Bardet-Biedl tipo 6NM_018848.3NM_018848.3:c.830T>C, NM_018848.3:c.1436C>G250,600
MKKSSíndrome de McKusick KaufmanNM_018848.3NM_018848.3:c.250C>T, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.724G>T250,600
MKS1Síndrome de Bardet-Biedl tipo 13NM_017777.3NM_017777.3:c.1349T>C250,600
MKS1Síndrome de Meckel tipo 1/Bardet-BiedlNM_017777.3NM_017777.3:c.1024+1G>A, NM_017777.3:c.857A>G, NM_017777.3:c.1319T>C, NM_017777.3:c.814G>C, NM_017777.3:c.508C>T, NM_017777.3:c.1319G>C250,600
MLC1Leucoencefalopatía megalencefálica con quistes subcorticalesNM_015166.3NM_015166.3:c.135_136insC, NM_015166.3:c.206C>T, NM_015166.3:c.278C>T, NM_015166.3:c.424-2A>C, NM_015166.3:c.422A>G, NM_015166.3:c.274C>T, NM_015166.3:c.839C>T, NM_015166.3:c.423C>A, NM_015166.3:c.33_34insC600
MLYCDDeficiencia de malonil-CoA-descarboxilasaNM_012213.2NM_012213.2:c.758delT, NM_012213.2:c.679delinsATGAAGC, NM_012213.2:c.560C>G600
MMAAAcidemia metilmalónica vitamina B12 sensible tipo cbl ANM_172250.2NM_172250.2:c.1034delT, NM_172250.2:c.283C>T, NM_172250.2:c.440G>A, NM_172250.2:c.451delC, NM_172250.2:c.592_595delCTGA, NM_172250.2:c.503delC, NM_172250.2:c.450_451insG, NM_172250.2:c.811G>T, NM_172250.2:c.586C>T, NM_172250.2:c.387C>A, NM_172250.2:c.620A>G600
MMABAcidemia metilmalónica vitamina B12 sensible tipo cbl BNM_052845.3NM_052845.3:c.557G>A, NM_052845.3:c.556C>T, NM_052845.3:c.569G>A, NM_052845.3:c.568C>T, NM_052845.3:c.577G>A, NM_052845.3:c.197-1G>T, NM_052845.3:c.700C>T, NM_052845.3:c.548A>T, NM_052845.3:c.220G>T, NM_052845.3:c.197-1G>A600
MMACHCAcidemia metilmalónica con homocistinuria tipo cblCNM_015506.2NM_015506.2:c.389A>G, NM_015506.2:c.388T>C, NM_015506.2:c.482G>A, NM_015506.2:c.609G>A, NM_015506.2:c.688C>T, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.608G>A, NM_015506.2:c.481C>T, NM_015506.2:c.619_620insG, NM_015506.2:c.547_548delGT, NM_015506.2:c.347T>C, NM_015506.2:c.658_660delAAG, NM_015506.2:c.388_390delTAC, NM_015506.2:c.615C>A, NM_015506.2:c.331C>T, NM_015506.2:c.616C>T, NM_015506.2:c.270_271insA, NM_015506.2:c.271dupA, NM_015506.2:c.615C>G250,600
MMADHCAcidemia metilmalónica con homocistinuria tipo cblDNM_015702.2NM_015702.2:c.545C>A, NM_015702.2:c.746A>G, NM_015702.2:c.419dupA, NM_015702.2:c.748C>T, NM_015702.2:c.795_796insT, NM_015702.2:c.57_64delCTCTTTAG, NM_015702.2:c.737A>G, NM_015702.2:c.776T>C, NM_015702.2:c.478+1G>T600
MOCS1Déficit del cofactor molibdeno tipo ANM_005943.5NM_005943.5:c.218G>A, NM_005943.5:c.397_406delCCGGACGTGG, NM_005943.5:c.217C>T, NM_005943.5:c.956G>A, NM_005943.5:c.1027C>T600
MOCS2Déficit del cofactor molibdeno tipo BNM_176806.3NM_176806.3:c.106_107delAT, NM_176806.3:c.*297+1G>A, NM_176806.3:c.58delT, NM_176806.3:c.245delT, NM_176806.3:c.190G>A, NM_176806.3:c.16C>T, NM_176806.3:c.*487A>C, NM_176806.3:c.*422G>A, NM_176806.3:c.*26_*27delAT, NM_176806.3:c.539_540delAA, NM_176806.3:c.*459_*460delAA250,600
MPITrastorno congénito de la glicosilación tipo 1bNM_002435.2NM_002435.2:c.305C>T, NM_002435.2:c.656G>A, NM_002435.2:c.982C>T, NM_002435.2:c.413T>C, NM_002435.2:c.884G>A, NM_002435.2:c.1016_1019delACCC600
MPV17Síndrome de depleción del ADN mitocondrial tipo 6NM_002437.4NM_002437.4:c.263_265delAGA, NM_002437.4:c.148C>T, NM_002437.4:c.149G>A, NM_002437.4:c.263A>T, NM_002437.4:c.284_285insG, NM_002437.4:c.498C>A, NM_002437.4:c.462-2A>C, NM_002437.4:c.70G>T, NM_002437.4:c.359G>A600
MPZSíndrome de Dejerine-Sottas (MPZ)NM_000530.6NM_000530.6:c.661G>A, NM_000530.6:c.380G>A, NM_000530.6:c.123_125delTGT, NM_000530.6:c.407T>A, NM_000530.6:c.560_563dupAGGC, NM_000530.6:c.355_356insTCTACT, NM_000530.6:c.661_662dupGC, NM_000530.6:c.411C>T, NM_000530.6:c.188C>G, NM_000530.6:c.506delT, NM_000530.6:c.190_192delTTC, NM_000530.6:c.496_499delCTCGinsTCC, NM_000530.6:c.372_377delGTTCAC, NM_000530.6:c.89T>C, NM_000530.6:c.499G>C, NM_000530.6:c.368G>A600
MPZNeuropatía congénita hipo o amielinizanteNM_000530.6NM_000530.6:c.588dupT, NM_000530.6:c.626_630delCGTCG, NM_000530.6:c.392A>G, NM_000530.6:c.578G>A, NM_000530.6:c.397C>T, NM_000530.6:c.164G>T, NM_000530.6:c.150C>G, NM_000530.6:c.142C>G, NM_000530.6:c.130_137delTCCCGGGT, NM_000530.6:c.128G>T, NM_000530.6:c.549dupG, NM_000530.6:c.106A>G, NM_000530.6:c.410G>C, NM_000530.6:c.332C>T, NM_000530.6:c.371C>A, NM_000530.6:c.368_382delGCACGTTCACTTGTG, NM_000530.6:c.382G>A, NM_000530.6:c.393C>A, NM_000530.6:c.103G>T, NM_000530.6:c.88A>T, NM_000530.6:c.106A>T, NM_000530.6:c.419C>G600
MRPS16Déficit combinado de la fosforilación oxidativa tipo 2NM_016065.3NM_016065.3:c.2T>C, NM_016065.3:c.331C>T600
MRPS22Déficit combinado de la fosforilación oxidativa tipo 5NM_020191.2NM_020191.2:c.509G>A, NM_020191.2:c.644T>C, NM_020191.2:c.40_41insA600
MTHFRHomocistinuria por déficit de metilentetrahidrofolato reductasaNM_005957.4NM_005957.4:c.1743G>A, NM_005957.4:c.3G>A, NM_005957.4:c.547C>T, NM_005957.4:c.1129C>T, NM_005957.4:c.1768delC, NM_005957.4:c.968T>C, NM_005957.4:c.971A>G, NM_005957.4:c.439C>T600
MTM1Miopatía centronuclear ligada al XNM_000252.2NM_000252.2:c.1415_1416delGT, NM_000252.2:c.1357_1358delCC, NM_000252.2:c.461T>G, NM_000252.2:c.420C>G, NM_000252.2:c.595_599delCCTGC, NM_000252.2:c.1261-10A>G, NM_000252.2:c.780T>A, NM_000252.2:c.670C>T, NM_000252.2:c.1306_1310dupCCTAT, NM_000252.2:c.969delA, NM_000252.2:c.721C>T, NM_000252.2:c.70C>T, NM_000252.2:c.969dupA600
MTMR2Enfermedad de Charcot-Marie-Tooth tipo 4B1NM_016156.5NM_016156.5:c.88C>T, NM_016156.5:c.304C>T, NM_016156.5:c.1276C>T, NM_016156.5:c.88A>T600
MTTPAbetalipoproteinemiaNM_000253.3NM_000253.3:c.1769G>T, NM_000253.3:c.2030delC, NM_000253.3:c.1619G>A, NM_000253.3:c.2593G>T, NM_000253.3:c.708_709delCA, NM_000253.3:c.1867+1G>A, NM_000253.3:c.703_704delAC250,600
MUTAcidemia metilmalónicaNM_000255.3NM_000255.3:c.1420C>T, NM_000255.3:c.1445-2A>G, NM_000255.3:c.2080C>T, NM_000255.3:c.1867G>A, NM_000255.3:c.607G>A, NM_000255.3:c.1658delT, NM_000255.3:c.1280G>A, NM_000255.3:c.1399C>T, NM_000255.3:c.914T>C, NM_000255.3:c.643G>A, NM_000255.3:c.655A>T, NM_000255.3:c.1741C>T, NM_000255.3:c.1106G>A, NM_000255.3:c.1871A>G, NM_000255.3:c.1924G>C, NM_000255.3:c.682C>T, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.1181T>A, NM_000255.3:c.278G>A, NM_000255.3:c.678_679insAATTTATG, NM_000255.3:c.794dupT, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.2150G>T, NM_000255.3:c.280G>A, NM_000255.3:c.91C>T, NM_000255.3:c.1207C>T250,600
MVKSíndrome Hiper-IgDNM_000431.3NM_000431.3:c.829C>T, NM_000431.3:c.803T>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.59A>C, NM_000431.3:c.1129G>A250,600
MVKAciduria mevalónicaNM_000431.3NM_000431.3:c.1000G>A, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A250,600
MYO15ASordera tipo 3 autosómica recesivaNM_016239.3NM_016239.3:c.3385C>T, NM_016239.3:c.6003delG, NM_016239.3:c.6004delG, NM_016239.3:c.10573delA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.755dupA, NM_016239.3:c.5492G>T, NM_016239.3:c.4351G>A, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.625G>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.6614C>T, NM_016239.3:c.6743C>T, NM_016239.3:c.6046+2T>G, NM_016239.3:c.5326C>T, NM_016239.3:c.3756+1G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT, NM_016239.3:c.8148G>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.4750_4751insTC, NM_016239.3:c.8548C>T250,600
MYO3ASordera tipo 30 autosómica recesivaNM_017433.4NM_017433.4:c.1086T>G, NM_017433.4:c.2793+2T>A, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A, NM_017433.4:c.1A>G, NM_017433.4:c.2506-1G>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1952delC, NM_017433.4:c.1193C>A, NM_017433.4:c.770C>G, NM_017433.4:c.3154C>T, NM_017433.4:c.585+5G>C, NM_017433.4:c.2243delA, NM_017433.4:c.3112-2A>G, NM_017433.4:c.732-2A>G250,600
MYO5AEnfermedad de Griscelli tipo 1NM_000259.3NM_000259.3:c.1145delC, NM_000259.3:c.2332C>T600
MYO6Sordera tipo 37 autosómica recesivaNM_004999.3NM_004999.3:c.2897_2899delAAG, NM_004999.3:c.2840G>A, NM_004999.3:c.647A>T, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T, NM_004999.3:c.1446_1447insT250,600
MYO7ASordera tipo 2 autosómica recesivaNM_000260.3NM_000260.3:c.1797G>A, NM_000260.3:c.2023C>T, NM_000260.3:c.731G>C, NM_000260.3:c.3596dupT, NM_000260.3:c.1184G>A, NM_000260.3:c.133-2A>G250,600
MYO7ASíndrome de Usher tipo 1BNM_000260.3NM_000260.3:c.1996C>T, NM_000260.3:c.1884C>A, NM_000260.3:c.448C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.4024delT, NM_000260.3:c.2617C>T, NM_000260.3:c.5227C>T, NM_000260.3:c.1344-1G>A, NM_000260.3:c.5507T>G, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.4018G>A, NM_000260.3:c.5392C>T, NM_000260.3:c.640G>A, NM_000260.3:c.3134T>C, NM_000260.3:c.5824G>T, NM_000260.3:c.3G>A, NM_000260.3:c.494C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5884_5887delTTCT, NM_000260.3:c.634C>T, NM_000260.3:c.3719G>A, NM_000260.3:c.5967C>G, NM_000260.3:c.3763delA, NM_000260.3:c.635G>A, NM_000260.3:c.6025delG250,600
NAGAEnfermedad de SchindlerNM_000262.2NM_000262.2:c.973G>A, NM_000262.2:c.985C>T, NM_000262.2:c.986G>A, NM_000262.2:c.577G>T250,600
NAGSHiperamoniaquemia por déficit de N-Acetilglutamato sintasaNM_153006.2NM_153006.2:c.971G>A, NM_153006.2:c.1289T>C, NM_153006.2:c.1025delG, NM_153006.2:c.916-2A>T, NM_153006.2:c.1307dupT, NM_153006.2:c.1299G>C600
NDRG1Enfermedad de Charcot-Marie-Tooth tipo 4DNM_006096.3NM_006096.3:c.16C>T, NM_006096.3:c.-18-2_-18-1delAG, NM_006096.3:c.538-1G>A, NM_006096.3:c.-18-2_-18-1del1, NM_006096.3:c.928C>T, NM_006096.3:c.442C>T600
NEBMiopatía nemalínica tipo 2NM_004543.4NM_004543.4:c.11474_11475delTG, NM_004543.4:c.19119_19120delGA, NM_004543.4:c.19306-1G>A, NM_004543.4:c.19606G>T, NM_004543.4:c.6105dupT, NM_004543.4:c.3191A>G, NM_004543.4:c.18318_18319delAG, NM_004543.4:c.11473_11474delAT, NM_004543.4:c.2173G>T, NM_004543.4:c.19097_19098delTT, NM_004543.4:c.19836+1_19836+2insATGGA, NM_004543.4:c.18825+1370C>T, NM_004543.4:c.5567G>A, NM_004543.4:c.6105_6106insT, NM_004543.4:c.16842+1G>A, NM_004543.4:c.843T>G, NM_004543.4:c.8031_8041delAAATAAACGAG, NM_004543.4:c.14182_14183delGCinsAA, NM_004543.4:c.15973C>T250,600
NEFLEnfermedad de Charcot-Marie-Tooth tipo 1FNM_006158.3NM_006158.3:c.418G>T, NM_006158.3:c.628G>T, NM_006158.3:c.361G>T600
NEUROG3Diarrea congénita con malabsoción tipo 4NM_020999.3NM_020999.3:c.319C>A, NM_020999.3:c.278G>T600
NHP2Disqueratosis congénita tipo 2 autosomica recesivaNM_017838.3NM_017838.3:c.415T>C, NM_017838.3:c.460T>A, NM_017838.3:c.289_290delAT600
NMNAT1Amaurosis congénita de Leber tipo 9NM_022787.3NM_022787.3:c.451G>T, NM_022787.3:c.25G>A, NM_022787.3:c.457C>G, NM_022787.3:c.507G>A, NM_022787.3:c.710G>T, NM_022787.3:c.619C>T, NM_022787.3:c.769G>A250,600
NOP10Disqueratosis congénita tipo 1 autosomica recesivaNM_018648.3NM_018648.3:c.34G>C, NM_018648.3:c.100C>T600
NPC1Enfermedad de Niemann-Pick tipo C1NM_000271.4NM_000271.4:c.1042C>T, NM_000271.4:c.2842G>A, NM_000271.4:c.1628C>T, NM_000271.4:c.2974G>T, NM_000271.4:c.3019C>G, NM_000271.4:c.1211G>A, NM_000271.4:c.2072C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.337T>C, NM_000271.4:c.3107C>T, NM_000271.4:c.530G>A, NM_000271.4:c.743G>T, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.813_815delCAT, NM_000271.4:c.2932C>T, NM_000271.4:c.3425T>C, NM_000271.4:c.2761C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3662delT, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2974G>A, NM_000271.4:c.2873G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.3182T>C, NM_000271.4:c.3467A>G, NM_000271.4:c.3175C>T, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A250,600
NPC2Enfermedad de Niemann-Pick tipo C2NM_006432.3NM_006432.3:c.115G>A, NM_006432.3:c.190+5G>A, NM_006432.3:c.27delG, NM_006432.3:c.352G>T, NM_006432.3:c.58G>T, NM_006432.3:c.358C>T, NM_006432.3:c.295T>C, NM_006432.3:c.441+1G>A, NM_006432.3:c.436C>T250,600
NPHP1Nefronoptisis tipo 1NM_000272.3NM_000272.3:c.80T>A, NM_000272.3:c.1delA, NM_000272.3:c.555_556insA, NM_000272.3:c.829C>T, NM_000272.3:c.455C>G, NM_000272.3:c.1884+1G>T, NM_000272.3:c.1184dupC600
NPHP3Nefronoptisis tipo 3NM_153240.4NM_153240.4:c.1817G>A, NM_153240.4:c.434_437delAAAG, NM_153240.4:c.1119-2A>G, NM_153240.4:c.1729C>T, NM_153240.4:c.2694-2A>G, NM_153240.4:c.1985+5G>A, NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.1157A>G, NM_153240.4:c.2369T>C, NM_153240.4:c.3550G>A, NM_153240.4:c.2541delG, NM_153240.4:c.2570+1G>T, NM_153240.4:c.3156_3157insA, NM_153240.4:c.3662C>T250,600
NPHP4Nefronoptisis type 4NM_015102.4NM_015102.4:c.4179T>A, NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3674C>T, NM_015102.4:c.556_557insT, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.3231+1G>C, NM_015102.4:c.517C>T, NM_015102.4:c.2335C>T, NM_015102.4:c.2219G>A, NM_015102.4:c.7G>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C250,600
NPHS1Síndrome nefrótico tipo 1NM_004646.3NM_004646.3:c.59-5C>G, NM_004646.3:c.3109+1G>A, NM_004646.3:c.3478C>T, NM_004646.3:c.121_122delCT, NM_004646.3:c.1481delC, NM_004646.3:c.2456A>T, NM_004646.3:c.2491C>T, NM_004646.3:c.2464G>A, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.3250delG, NM_004646.3:c.3325C>T, NM_004646.3:c.2928G>T, NM_004646.3:c.3250_3251insG, NM_004646.3:c.2746G>T, NM_004646.3:c.1715G>A250,600
NR0B1Hipoplasia adrenal congénita citomegálicaNM_000475.4NM_000475.4:c.513G>A, NM_000475.4:c.591C>A, NM_000475.4:c.315G>C, NM_000475.4:c.873G>C, NM_000475.4:c.800G>C, NM_000475.4:c.788T>A, NM_000475.4:c.704G>A, NM_000475.4:c.1319A>T, NM_000475.4:c.388_389delTA, NM_000475.4:c.273C>A, NM_000475.4:c.813C>G, NM_000475.4:c.847C>T, NM_000475.4:c.1107G>A, NM_000475.4:c.890T>C, NM_000475.4:c.1316T>G600
NR2E3Síndrome de incrementos de conos SNM_014249.3NM_014249.3:c.119-2A>C, NM_014249.3:c.297_298delGT, NM_014249.3:c.932G>A, NM_014249.3:c.226C>T, NM_014249.3:c.361G>A, NM_014249.3:c.227G>A, NM_014249.3:c.1034_1038delTGCAG250,600
NTRK1Neuropatía sensitiva y autonómica tipo 4NM_001012331.1NM_001012331.1:c.1076A>G, NM_001012331.1:c.1711G>C, NM_001012331.1:c.1741A>G, NM_001012331.1:c.1908_1909insT, NM_001012331.1:c.1709delT, NM_001012331.1:c.1942C>T, NM_001012331.1:c.1852C>T, NM_001012331.1:c.1456G>A, NM_001012331.1:c.2321G>C, NM_001012331.1:c.2066C>T600
NUP62Degeneración estriatal infantilNM_153719.3NM_153719.3:c.1172A>C600
NYXCeguera nocturna estacionaria congénita tipo 1A ligada al XNM_022567.2NM_022567.2:c.1049G>A600
OATAtrofia girada de coroides y retinaNM_000274.3NM_000274.3:c.1250C>T, NM_000274.3:c.159delC, NM_000274.3:c.1205T>C, NM_000274.3:c.901-2A>G, NM_000274.3:c.533G>A, NM_000274.3:c.1276C>T, NM_000274.3:c.824G>A, NM_000274.3:c.268C>G, NM_000274.3:c.952delG, NM_000274.3:c.994G>A, NM_000274.3:c.955C>T, NM_000274.3:c.677C>T, NM_000274.3:c.278G>T, NM_000274.3:c.627T>A, NM_000274.3:c.812G>A, NM_000274.3:c.952G>A, NM_000274.3:c.539G>C, NM_000274.3:c.596C>A600
OCA2Albinismo oculocutáneo tipo 2NM_000275.2NM_000275.2:c.1610A>G, NM_000275.2:c.1960delG, NM_000275.2:c.2359G>A, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.2228C>T, NM_000275.2:c.1025A>G, NM_000275.2:c.1842+1G>T, NM_000275.2:c.157delA, NM_000275.2:c.1182G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1441G>A, NM_000275.2:c.79G>A, NM_000275.2:c.1465A>G, NM_000275.2:c.1327G>A, NM_000275.2:c.1364+1G>T250,600
OCRLSíndrome LoweNM_000276.3NM_000276.3:c.2299C>T, NM_000276.3:c.909_910delAG, NM_000276.3:c.2535delA, NM_000276.3:c.2403dupA, NM_000276.3:c.1499G>A, NM_000276.3:c.2530C>T600
OFD1Síndrome de Joubert tipo 10NM_003611.2NM_003611.2:c.2582dupT, NM_003611.2:c.2321_2322insT, NM_003611.2:c.277G>T600
OFD1Síndrome orofaciodigital tipo 1NM_003611.2NM_003611.2:c.43_44delAG, NM_003611.2:c.52G>T, NM_003611.2:c.65dupA, NM_003611.2:c.221C>T, NM_003611.2:c.274T>C, NM_003611.2:c.616_617delGA, NM_003611.2:c.260A>G, NM_003611.2:c.13-10T>A, NM_003611.2:c.312+1delG, NM_003611.2:c.224A>C, NM_003611.2:c.294_312delTGGTTTGGCAAAAGAAAAG, NM_003611.2:c.62_63insT, NM_003611.2:c.275_276delCT, NM_003611.2:c.614_617delGAGA, NM_003611.2:c.225C>G, NM_003611.2:c.602delA, NM_003611.2:c.628C>T, NM_003611.2:c.653delA, NM_003611.2:c.1365_1368delACAA, NM_003611.2:c.619_624delATAGAA, NM_003611.2:c.1303A>C, NM_003611.2:c.1318delC, NM_003611.2:c.654+2_654+3delTA, NM_003611.2:c.1268_1272delAAAAC, NM_003611.2:c.1323_1326delAGAA, NM_003611.2:c.1360_1363delCTTA, NM_003611.2:c.1358T>A, NM_003611.2:c.1840delG, NM_003611.2:c.1612C>T, NM_003611.2:c.1757delG, NM_003611.2:c.1821delG, NM_003611.2:c.1319delT, NM_003611.2:c.1859_1860delCCinsG, NM_003611.2:c.2261-1G>T, NM_003611.2:c.235G>A, NM_003611.2:c.607_610delTATA, NM_003611.2:c.594_598delAAAGC, NM_003611.2:c.247C>T, NM_003611.2:c.2387+1G>C, NM_003611.2:c.290A>G, NM_003611.2:c.454C>T, NM_003611.2:c.312+2_312+7delTAAAGT, NM_003611.2:c.413-10T>G, NM_003611.2:c.2349delC, NM_003611.2:c.518-1G>A, NM_003611.2:c.1322_1326delAAGAA, NM_003611.2:c.541dupG, NM_003611.2:c.243C>G, NM_003611.2:c.241C>G600
OPA3Aciduria 3-metilglutacónica tipo 3NM_025136.3NM_025136.3:c.*24136delG, NM_025136.3:c.221delG600
OSTM1Osteopetrosis tipo 5 autosómica recesivaNM_014028.3NM_014028.3:c.415_416delAG600
OTCDéficit de ornitina transcarbamilasaNM_000531.5NM_000531.5:c.119G>A, NM_000531.5:c.259G>A, NM_000531.5:c.118C>T, NM_000531.5:c.617T>G, NM_000531.5:c.646C>G, NM_000531.5:c.148G>T, NM_000531.5:c.589G>T, NM_000531.5:c.77G>A, NM_000531.5:c.829C>T, NM_000531.5:c.674C>T, NM_000531.5:c.717+2T>C, NM_000531.5:c.563G>T, NM_000531.5:c.275G>A, NM_000531.5:c.245T>G, NM_000531.5:c.460G>T, NM_000531.5:c.134T>C, NM_000531.5:c.332T>C, NM_000531.5:c.238A>G, NM_000531.5:c.421C>T600
OTOASordera tipo 22 autosómica recesivaNM_144672.3NM_144672.3:c.2301+1G>T, NM_144672.3:c.2359G>T, NM_144672.3:c.121-1G>A, NM_144672.3:c.827delT, NM_144672.3:c.1725_1726delCA250,600
OTOFSordera tipo 9 autosómica recesivaNM_194248.2NM_194248.2:c.149G>A, NM_194248.2:c.1867G>A, NM_194248.2:c.1669G>A, NM_194248.2:c.2381G>A, NM_194248.2:c.1498C>T, NM_194248.2:c.1544T>C, NM_194248.2:c.5473C>G, NM_194248.2:c.1150G>A, NM_194248.2:c.1778delT, NM_194248.2:c.5103+2T>A, NM_194248.2:c.227+2T>C, NM_194248.2:c.5474_5475delCC, NM_194248.2:c.5332G>A, NM_194248.2:c.584-1G>C, NM_194248.2:c.98G>A, NM_194248.2:c.2348delG, NM_194248.2:c.3032T>C, NM_194248.2:c.4559G>A, NM_194248.2:c.4491T>A, NM_194248.2:c.5816G>A, NM_194248.2:c.766-2A>G, NM_194248.2:c.2485C>T, NM_194248.2:c.2401G>T250,600
PAHFenilcetonuriaNM_000277.1NM_000277.1:c.1139C>T, NM_000277.1:c.1066-3C>T, NM_000277.1:c.117C>G, NM_000277.1:c.1166delC, NM_000277.1:c.1068C>A, NM_000277.1:c.1315+1G>A, NM_000277.1:c.1162G>A, NM_000277.1:c.143T>C, NM_000277.1:c.1243G>A, NM_000277.1:c.1169A>G, NM_000277.1:c.136G>A, NM_000277.1:c.1184C>A, NM_000277.1:c.194T>C, NM_000277.1:c.1199+17G>A, NM_000277.1:c.232G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1197A>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.450_451insA, NM_000277.1:c.472C>T, NM_000277.1:c.204A>T, NM_000277.1:c.482T>C, NM_000277.1:c.250G>T, NM_000277.1:c.261C>A, NM_000277.1:c.1030G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1238G>C, NM_000277.1:c.1241A>G, NM_000277.1:c.673C>G, NM_000277.1:c.688G>A, NM_000277.1:c.721C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.727C>T, NM_000277.1:c.728G>A, NM_000277.1:c.733G>C, NM_000277.1:c.734T>C, NM_000277.1:c.737C>A, NM_000277.1:c.745C>T, NM_000277.1:c.1042C>G, NM_000277.1:c.638T>C, NM_000277.1:c.764T>C, NM_000277.1:c.782G>A, NM_000277.1:c.806delT, NM_000277.1:c.809G>A, NM_000277.1:c.814G>T, NM_000277.1:c.818C>T, NM_000277.1:c.823C>T, NM_000277.1:c.829T>G, NM_000277.1:c.898G>T, NM_000277.1:c.912+1G>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.754C>T, NM_000277.1:c.755G>A, NM_000277.1:c.357delC, NM_000277.1:c.1217T>C, NM_000277.1:c.1222C>T, NM_000277.1:c.157C>T, NM_000277.1:c.158G>A, NM_000277.1:c.165T>G, NM_000277.1:c.473G>A, NM_000277.1:c.490A>G, NM_000277.1:c.503delA, NM_000277.1:c.508C>G, NM_000277.1:c.533A>G, NM_000277.1:c.665A>G, NM_000277.1:c.838G>A, NM_000277.1:c.842+5G>A, NM_000277.1:c.896T>G, NM_000277.1:c.320A>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.311C>A, NM_000277.1:c.527G>T, NM_000277.1:c.529G>A, NM_000277.1:c.47_48delCT, NM_000277.1:c.1208C>T, NM_000277.1:c.331C>T, NM_000277.1:c.926C>T, NM_000277.1:c.955G>T, NM_000277.1:c.926C>A, NM_000277.1:c.509+1G>A, NM_000277.1:c.1033G>T, NM_000277.1:c.611A>G, NM_000277.1:c.1066-11G>A, NM_000277.1:c.569T>C250,600
PALB2Anemia de Fanconi grupo de complementación NNM_024675.3NM_024675.3:c.1882_1890delAAGTCCTGC, NM_024675.3:c.2962C>T, NM_024675.3:c.50T>G, NM_024675.3:c.3116delA, NM_024675.3:c.3287A>G, NM_024675.3:c.3549C>G, NM_024675.3:c.3113G>A, NM_024675.3:c.2816T>G, NM_024675.3:c.1240C>T, NM_024675.3:c.557_558insA250,600
PANK2Neurodegeneración asociada a pantotenato-quinasaNM_153638.2NM_153638.2:c.1561G>A, NM_153638.2:c.688G>A, NM_153638.2:c.790C>T, NM_153638.2:c.821_822delCT, NM_153638.2:c.1583C>T, NM_153638.2:c.1211A>T250,600
PAX3Síndrome de Waardenburg tipo 3NM_181457.3NM_181457.3:c.268T>C, NM_181457.3:c.251C>T600
PAX6AniridiaNM_000280.4NM_000280.4:c.1032+3A>T, NM_000280.4:c.978_979delCA, NM_000280.4:c.949C>T, NM_000280.4:c.1124C>A, NM_000280.4:c.1032+3_1032+6delAAGT, NM_000280.4:c.917-2A>T, NM_000280.4:c.1000_1001insTGGCATATAACCT, NM_000280.4:c.891delA, NM_000280.4:c.889dupC, NM_000280.4:c.890_905delAACCAATTCCACAACC, NM_000280.4:c.921_924dupCTCC, NM_000280.4:c.888C>G, NM_000280.4:c.887dupA, NM_000280.4:c.889C>T, NM_000280.4:c.888C>A, NM_000280.4:c.868_871dupAGTT, NM_000280.4:c.847_854dupAGTCATAT, NM_000280.4:c.879dupC, NM_000280.4:c.875G>T, NM_000280.4:c.839delA, NM_000280.4:c.829C>T, NM_000280.4:c.818delA, NM_000280.4:c.844_845delCC, NM_000280.4:c.812_813delTG, NM_000280.4:c.808A>T, NM_000280.4:c.799A>T, NM_000280.4:c.818dupA, NM_000280.4:c.794G>A, NM_000280.4:c.781C>T, NM_000280.4:c.775dupT, NM_000280.4:c.795G>A, NM_000280.4:c.1031A>G, NM_000280.4:c.1016_1019delATAA, NM_000280.4:c.1017delT, NM_000280.4:c.766-1G>C, NM_000280.4:c.766-2delA, NM_000280.4:c.760_765+9delATACAGGTACCGAGA, NM_000280.4:c.765G>C, NM_000280.4:c.765G>T, NM_000280.4:c.763C>T, NM_000280.4:c.742_752delGATCTACCTGA, NM_000280.4:c.745delC, NM_000280.4:c.916+2T>G, NM_000280.4:c.847_848dupAG, NM_000280.4:c.916+1G>C, NM_000280.4:c.689delA, NM_000280.4:c.683-2A>C, NM_000280.4:c.683-5_683-4delTTinsAAC, NM_000280.4:c.683-6T>A, NM_000280.4:c.683-9C>G, NM_000280.4:c.682+2T>A, NM_000280.4:c.673delC, NM_000280.4:c.668delA, NM_000280.4:c.656_665delAAGAGCAAAT, NM_000280.4:c.661C>T, NM_000280.4:c.658G>T, NM_000280.4:c.655C>T, NM_000280.4:c.646T>C, NM_000280.4:c.642A>C, NM_000280.4:c.639_640delTA, NM_000280.4:c.640A>G, NM_000280.4:c.640A>T, NM_000280.4:c.631C>T, NM_000280.4:c.623G>A, NM_000280.4:c.622C>T, NM_000280.4:c.613C>T, NM_000280.4:c.607C>T, NM_000280.4:c.601C>T, NM_000280.4:c.595G>T, NM_000280.4:c.580G>T, NM_000280.4:c.773T>C, NM_000280.4:c.771G>A, NM_000280.4:c.770G>A, NM_000280.4:c.766-1G>A, NM_000280.4:c.535C>T, NM_000280.4:c.534G>T, NM_000280.4:c.532C>T, NM_000280.4:c.524-2A>G, NM_000280.4:c.520C>T, NM_000280.4:c.500_501delCGinsGA, NM_000280.4:c.490_500delCCGGGGACTTCinsTCGGTA, NM_000280.4:c.500C>A, NM_000280.4:c.495delG, NM_000280.4:c.491delC, NM_000280.4:c.489T>G, NM_000280.4:c.480delT, NM_000280.4:c.475delC, NM_000280.4:c.470delG, NM_000280.4:c.468G>A, NM_000280.4:c.467G>A, NM_000280.4:c.464delG, NM_000280.4:c.459dupC, NM_000280.4:c.454C>T, NM_000280.4:c.450delC, NM_000280.4:c.432dupT, NM_000280.4:c.428_431delATGA, NM_000280.4:c.406C>T, NM_000280.4:c.403C>T, NM_000280.4:c.402delG, NM_000280.4:c.397G>T, NM_000280.4:c.383G>C, NM_000280.4:c.382C>T, NM_000280.4:c.366_379delAATAAACAGAGTTC, NM_000280.4:c.377T>A, NM_000280.4:c.375_376delAG, NM_000280.4:c.370_373delAACA, NM_000280.4:c.371delA, NM_000280.4:c.362_368dupCATCAAT, NM_000280.4:c.365C>A, NM_000280.4:c.362C>T, NM_000280.4:c.361T>C, NM_000280.4:c.358-1G>A, NM_000280.4:c.358-1G>C, NM_000280.4:c.357_357+5delCGTAAG, NM_000280.4:c.357+5G>A, NM_000280.4:c.357+2dupT, NM_000280.4:c.357+1G>A, NM_000280.4:c.357+1G>C, NM_000280.4:c.357+1G>T, NM_000280.4:c.349_357delATACCAAGC, NM_000280.4:c.339_357dupCAACGATAACATACCAAGC, NM_000280.4:c.353_357dupCAAGC, NM_000280.4:c.357C>G, NM_000280.4:c.357C>A, NM_000280.4:c.343_356dupGATAACATACCAAG, NM_000280.4:c.342_355delCGATAACATACCAA, NM_000280.4:c.350_354dupTACCA, NM_000280.4:c.353C>G, NM_000280.4:c.353C>A, NM_000280.4:c.348delC, NM_000280.4:c.344delA, NM_000280.4:c.331delG, NM_000280.4:c.331dupG, NM_000280.4:c.316_326delTTACTGTCCGA, NM_000280.4:c.316_326delTTACTGTCCGAinsCCCCCCGTT, NM_000280.4:c.325_326delGAinsCAG, NM_000280.4:c.325G>T, NM_000280.4:c.317T>A, NM_000280.4:c.307C>T, NM_000280.4:c.301delG, NM_000280.4:c.300G>A, NM_000280.4:c.299G>A, NM_000280.4:c.295G>C, NM_000280.4:c.284dupC, NM_000280.4:c.277G>A, NM_000280.4:c.277G>T, NM_000280.4:c.270delT, NM_000280.4:c.265dupC, NM_000280.4:c.265C>T, NM_000280.4:c.260T>G, NM_000280.4:c.260T>A, NM_000280.4:c.251dupT, NM_000280.4:c.236_244delCGACTCCAGinsTTGTAAGCAA, NM_000280.4:c.235_238dupGCGA, NM_000280.4:c.236_237delCGinsTTTGCTTACA, NM_000280.4:c.236C>A, NM_000280.4:c.233T>C, NM_000280.4:c.215_228delGTGGTAGTAAACCG, NM_000280.4:c.222_228dupTAAACCG, NM_000280.4:c.227C>G, NM_000280.4:c.220A>G, NM_000280.4:c.218G>A, NM_000280.4:c.215dupG, NM_000280.4:c.214G>A, NM_000280.4:c.210_213delAATCinsGGTAGTACACCCAG, NM_000280.4:c.202C>T, NM_000280.4:c.199A>T, NM_000280.4:c.191G>T, NM_000280.4:c.181_189delTACGAGACTinsCA, NM_000280.4:c.184_188dupGAGAC, NM_000280.4:c.187A>C, NM_000280.4:c.183delC, NM_000280.4:c.183C>A, NM_000280.4:c.177delG, NM_000280.4:c.175delA, NM_000280.4:c.170_174delTGGGC, NM_000280.4:c.164_170delAAATTCT, NM_000280.4:c.168delT, NM_000280.4:c.167T>C, NM_000280.4:c.164A>G, NM_000280.4:c.158_159delTG, NM_000280.4:c.157G>C, NM_000280.4:c.154T>C, NM_000280.4:c.142-1_153dupGGTGTCCAACGGA, NM_000280.4:c.152G>C, NM_000280.4:c.152G>T, NM_000280.4:c.151G>A, NM_000280.4:c.146C>T, NM_000280.4:c.143T>A, NM_000280.4:c.142delG, NM_000280.4:c.142-1G>T, NM_000280.4:c.555_556delGA, NM_000280.4:c.541G>T, NM_000280.4:c.539delA, NM_000280.4:c.538C>T, NM_000280.4:c.10+5G>C, NM_000280.4:c.10+3_10+4delAAinsGC, NM_000280.4:c.4delC, NM_000280.4:c.4C>T, NM_000280.4:c.3delG, NM_000280.4:c.1_2delATinsCA, NM_000280.4:c.2T>A, NM_000280.4:c.2T>G, NM_000280.4:c.1A>G, NM_000280.4:c.917-1G>C, NM_000280.4:c.736A>T, NM_000280.4:c.916+1G>A, NM_000280.4:c.711_712delGT, NM_000280.4:c.142-99A>G, NM_000280.4:c.901C>T, NM_000280.4:c.924delC, NM_000280.4:c.1032+2T>A, NM_000280.4:c.917-1G>A, NM_000280.4:c.142-3C>G, NM_000280.4:c.142-117T>A, NM_000280.4:c.1032+1G>A, NM_000280.4:c.718C>T, NM_000280.4:c.142-2A>G600
PCDéficit de piruvato carboxilasaNM_000920.3NM_000920.3:c.434T>C, NM_000920.3:c.1748G>T, NM_000920.3:c.496G>A250,600
PCCAAcidemia propiónica tipo 1NM_000282.3NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.412G>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+1_1899+4delGTAA, NM_000282.3:c.1284+1G>A, NM_000282.3:c.229C>T, NM_000282.3:c.1023dupT, NM_000282.3:c.600+1G>A, NM_000282.3:c.261_262insT, NM_000282.3:c.1118T>A, NM_000282.3:c.862A>T250,600
PCCBAcidemia propiónica tipo 2NM_000532.4NM_000532.4:c.1279_1291delGTTCCCinsAA, NM_000532.4:c.1283C>T, NM_000532.4:c.337C>T, NM_000532.4:c.1538_1540dupCCC, NM_000532.4:c.990dupT, NM_000532.4:c.1304A>G, NM_000532.4:c.1228C>T, NM_000532.4:c.1229_1230insT, NM_000532.4:c.1606A>G, NM_000532.4:c.1223_1226delTCAT, NM_000532.4:c.1490C>T, NM_000532.4:c.1534C>T, NM_000532.4:c.1173_1174insT, NM_000532.4:c.1540_1541insCCC, NM_000532.4:c.331C>T, NM_000532.4:c.683C>T, NM_000532.4:c.797G>T, NM_000532.4:c.737G>T, NM_000532.4:c.1218_1231delinsTAGAGCACAGGA, NM_000532.4:c.502G>A, NM_000532.4:c.562G>A, NM_000532.4:c.1219_1224delGGCATCinsAA250,600
PCDH15Síndrome de Usher tipo 1FNM_033056.3NM_033056.3:c.1583T>A, NM_033056.3:c.4885delA, NM_033056.3:c.4961_4962insTGAT, NM_033056.3:c.5659A>T, NM_033056.3:c.4937_4940dupTGAT, NM_033056.3:c.785G>A, NM_033056.3:c.5622_5624delAAC, NM_033056.3:c.400C>T, NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT, NM_033056.3:c.4864delA, NM_033056.3:c.1737C>G, NM_033056.3:c.1021C>T, NM_033056.3:c.1088delT, NM_033056.3:c.1006C>T, NM_033056.3:c.1940C>G, NM_033056.3:c.400C>G, NM_033056.3:c.3718-2A>G, NM_033056.3:c.4548_4551dupATCT, NM_033056.3:c.7C>T, NM_033056.3:c.2645_2646delAT250,600
PDE6ARetinosis pigmentaria tipo 43NM_000440.2NM_000440.2:c.1683G>A, NM_000440.2:c.1113+1G>T, NM_000440.2:c.718-4_718-3insT, NM_000440.2:c.1749C>G, NM_000440.2:c.2053G>A, NM_000440.2:c.1560_1561insA, NM_000440.2:c.304C>A, NM_000440.2:c.1040C>T, NM_000440.2:c.1113+1G>A250,600
PDE6BRetinosis pigmentaria tipo 43NM_000283.3NM_000283.3:c.1580T>C, NM_000283.3:c.655T>C, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1920+2T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.892C>T250,600
PDE6CDistrofia de conos progresiva tipo 4NM_006204.3NM_006204.3:c.1682dupA, NM_006204.3:c.1805A>T, NM_006204.3:c.2283+1G>C, NM_006204.3:c.256_257insAG, NM_006204.3:c.1066G>T, NM_006204.3:c.881G>A, NM_006204.3:c.481-12T>A, NM_006204.3:c.1363A>G, NM_006204.3:c.2457T>A, NM_006204.3:c.826C>T, NM_006204.3:c.633G>C, NM_006204.3:c.2036+1G>T, NM_006204.3:c.85C>T, NM_006204.3:c.180_186delCCTGTGC600
PDE6GRetinosis pigmentaria tipo 57NM_002602.3NM_002602.3:c.187+1G>T600
PDHA1Déficit en piruvato deshidrogenasa E1-alfaNM_000284.3NM_000284.3:c.262C>T, NM_000284.3:c.787C>G, NM_000284.3:c.871G>A, NM_000284.3:c.773A>C600
PDP1Déficit de piruvato deshidrogenasa fosfatasaNM_018444.3NM_018444.3:c.597_601delCTTTA, NM_018444.3:c.1606C>T, NM_018444.3:c.277G>T, NM_018444.3:c.803delC, NM_018444.3:c.669_673delTTACT, NM_018444.3:c.672_676delCTTTA, NM_018444.3:c.878delC, NM_018444.3:c.851_853delTTC600
PDSS1Deficiencia primaria de coenzima Q10 tipo 2NM_014317.3NM_014317.3:c.319dupT, NM_014317.3:c.924T>G600
PDSS2Deficiencia primaria de coenzima Q10 tipo 3NM_020381.3NM_020381.3:c.964C>T, NM_020381.3:c.129_130insC, NM_020381.3:c.1145C>T600
PDX1Agenesia pancreáticaNM_000209.3NM_000209.3:c.532G>A, NM_000209.3:c.533A>G, NM_000209.3:c.492G>T600
PDZD7Síndrome de Usher tipo 2CNM_001195263.1NM_001195263.1:c.1543C>T, NM_001195263.1:c.166_167insC, NM_001195263.1:c.2107delA, NM_001195263.1:c.144_145insA600
PEX1Enfermedad de la biogénesis del peroxisoma tipo 1ANM_000466.2NM_000466.2:c.2097dupT, NM_000466.2:c.2916delA, NM_000466.2:c.1842delA, NM_000466.2:c.1991T>C, NM_000466.2:c.1239+1G>T250,600
PEX1Enfermedad de la biogénesis del peroxisoma tipo 1BNM_000466.2NM_000466.2:c.2097_2098insT, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.877C>T, NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2528G>A250,600
PEX12Enfermedad de la biogénisesis de peroxisomas grupo de complementación 6NM_000286.2NM_000286.2:c.959C>T, NM_000286.2:c.894delC, NM_000286.2:c.888_889delCT, NM_000286.2:c.538C>T, NM_000286.2:c.455_459dupGGAAA, NM_000286.2:c.771delC600
PEX2Enfermedad de la biogénesis del peroxisoma grupo de complementación 5NM_000318.2NM_000318.2:c.163G>A, NM_000318.2:c.789_790delCT600
PEX26Enfermedad de la biogénesis del peroxisoma tipo 7NM_017929.5NM_017929.5:c.292C>T, NM_017929.5:c.254dupT, NM_017929.5:c.265G>A, NM_017929.5:c.353C>G600
PEX5Enfermedad de la biogénesis del peroxisoma tipo 2NM_001131025.1NM_001131025.1:c.1578T>G, NM_001131025.1:c.1279C>T, NM_001131025.1:c.*20G>C600
PEX7Condrodisplasia punctata rizomélica tipo 1NM_000288.3NM_000288.3:c.694C>T, NM_000288.3:c.649G>A, NM_000288.3:c.618G>A, NM_000288.3:c.722A>T, NM_000288.3:c.875T>A, NM_000288.3:c.653C>T, NM_000288.3:c.854A>G, NM_000288.3:c.532C>T, NM_000288.3:c.903+1G>C250,600
PGM1Enfermedad congénita de glucosilación, tipo 1TNM_002633.2NM_002633.2:c.343A>G, NM_002633.2:c.361G>C, NM_002633.2:c.1507C>T, NM_002633.2:c.300+1G>A, NM_002633.2:c.787G>T600
PHKG2Enfermedad de almacenamiento de glucógeno tipo 9CNM_000294.2NM_000294.2:c.958C>T, NM_000294.2:c.553C>T, NM_000294.2:c.130C>T, NM_000294.2:c.393-2A>G600
PHYHEnfermedad de RefsumNM_006214.3NM_006214.3:c.135-2A>G, NM_006214.3:c.497-2A>G, NM_006214.3:c.135-1G>C, NM_006214.3:c.805A>C, NM_006214.3:c.678+5G>T, NM_006214.3:c.823C>T, NM_006214.3:c.530A>G, NM_006214.3:c.164delT, NM_006214.3:c.678+2T>G, NM_006214.3:c.824G>A250,600
PKHD1Poliquistosis renal autosómica recesivaNM_138694.3NM_138694.3:c.10515C>A, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10585G>C, NM_138694.3:c.107C>T, NM_138694.3:c.10452dupT, NM_138694.3:c.2452C>T, NM_138694.3:c.2747A>C, NM_138694.3:c.12027C>G, NM_138694.3:c.11284C>A, NM_138694.3:c.3367G>A, NM_138694.3:c.353delG, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2854G>A, NM_138694.3:c.1342G>C, NM_138694.3:c.1409G>A, NM_138694.3:c.11611T>C, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.2414C>T, NM_138694.3:c.5895_5896insA, NM_138694.3:c.5895dupA, NM_138694.3:c.6499C>T, NM_138694.3:c.664A>G, NM_138694.3:c.682A>G, NM_138694.3:c.6854G>A, NM_138694.3:c.370C>T, NM_138694.3:c.8407T>C, NM_138694.3:c.3766delC, NM_138694.3:c.3940delA, NM_138694.3:c.1486C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.10219C>T, NM_138694.3:c.9107T>G, NM_138694.3:c.930delC, NM_138694.3:c.9370C>T, NM_138694.3:c.9530T>C, NM_138694.3:c.9689delA, NM_138694.3:c.982C>T, NM_138694.3:c.9866G>T, NM_138694.3:c.10036T>C, NM_138694.3:c.3229-2A>C, NM_138694.3:c.4870C>T, NM_138694.3:c.4165C>A, NM_138694.3:c.9719G>A, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.5498C>T, NM_138694.3:c.8824C>T, NM_138694.3:c.85G>T, NM_138694.3:c.10412T>G, NM_138694.3:c.8518C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8317G>T, NM_138694.3:c.8870T>C250,600
PKLRAnemia hemolítica por déficit de piruvato quinasa de los glóbulos rojosNM_000298.5NM_000298.5:c.1151C>T, NM_000298.5:c.1706G>A, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1595G>A, NM_000298.5:c.721G>T, NM_000298.5:c.1076G>A, NM_000298.5:c.1675C>T, NM_000298.5:c.1261C>A, NM_000298.5:c.1436G>A, NM_000298.5:c.1456C>T250,600
PLA2G6Distrofia neuroaxonal infantilNM_003560.2NM_003560.2:c.1634A>C, NM_003560.2:c.238G>A, NM_003560.2:c.1903C>T, NM_003560.2:c.109C>T, NM_003560.2:c.1612C>T, NM_003560.2:c.2370T>G, NM_003560.2:c.929T>A, NM_003560.2:c.1894C>T, NM_003560.2:c.2239C>T600
PLCE1Síndrome nefrótico tipo 3NM_016341.3NM_016341.3:c.3346C>T, NM_016341.3:c.4808delA, NM_016341.3:c.3846delG, NM_016341.3:c.3736C>T, NM_016341.3:c.5560C>T, NM_016341.3:c.4451C>T, NM_016341.3:c.5669C>T, NM_016341.3:c.961C>T250,600
PLECEpidermólisis bullosa simple con distrofia muscularNM_000445.4NM_000445.4:c.6955C>T, NM_000445.4:c.9250_9251delCT, NM_000445.4:c.10971_10972delGA, NM_000445.4:c.2493+1G>C600
PLECEpidermólisis bullosa simple con atresia pilóricaNM_000445.4NM_000445.4:c.9085C>T, NM_000445.4:c.913C>T, NM_000445.4:c.906+1G>A, NM_000445.4:c.12043_12044insG, NM_000445.4:c.11446G>T600
PLEKHG5Enfermedad de Charcot-Marie-Tooth intermedia tipo CNM_020631.4NM_020631.4:c.440-2A>G, NM_020631.4:c.3166C>T, NM_020631.4:c.1940T>C, NM_020631.4:c.2935C>T600
PLGDéficit de plasminógeno tipo 1NM_000301.3NM_000301.3:c.704G>A, NM_000301.3:c.1848G>A, NM_000301.3:c.1435G>T, NM_000301.3:c.693_695delGAA, NM_000301.3:c.1120G>T, NM_000301.3:c.112A>G250,600
PLOD1Síndrome de Ehlers-Danlos tipo 6NM_000302.3NM_000302.3:c.955C>T, NM_000302.3:c.2032G>A, NM_000302.3:c.1533C>G, NM_000302.3:c.1836G>C, NM_000302.3:c.2008C>T, NM_000302.3:c.466+1G>A600
PLP1Enfermededad Pelizaeus-MerzbacherNM_000533.3NM_000533.3:c.128C>T, NM_000533.3:c.593delG, NM_000533.3:c.231_232insC, NM_000533.3:c.3G>A, NM_000533.3:c.487T>C, NM_000533.3:c.725C>T, NM_000533.3:c.737G>C, NM_000533.3:c.169G>T600
PLP1Paraplejía espástica ligada al X tipo 2NM_000533.3NM_000533.3:c.409C>T600
PMM2Trastorno congénito de la glicosilación tipo 1aNM_000303.2NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.255+2T>C, NM_000303.2:c.127G>C, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.323C>T, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.669C>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.95T>G, NM_000303.2:c.53C>G, NM_000303.2:c.710C>T, NM_000303.2:c.620T>C, NM_000303.2:c.97C>T, NM_000303.2:c.193G>T, NM_000303.2:c.338C>T, NM_000303.2:c.563A>G, NM_000303.2:c.131T>C, NM_000303.2:c.26G>A, NM_000303.2:c.109C>T, NM_000303.2:c.317A>T, NM_000303.2:c.190delT, NM_000303.2:c.256-1G>C250,600
PNPODéficit de PNPONM_018129.3NM_018129.3:c.685C>T, NM_018129.3:c.674G>A600
POLGSíndrome de depleción de ADN mitocondrial tipo AlpersNM_002693.2NM_002693.2:c.2617G>T, NM_002693.2:c.1120C>T, NM_002693.2:c.830A>T, NM_002693.2:c.3218C>T, NM_002693.2:c.3630dupC250,600
POLGOftalmoplegia externa progresivaNM_002693.2NM_002693.2:c.1437C>G, NM_002693.2:c.2591A>G, NM_002693.2:c.1754G>A, NM_002693.2:c.1399G>A, NM_002693.2:c.1491G>C, NM_002693.2:c.3151G>C, NM_002693.2:c.803G>C, NM_002693.2:c.3286C>T, NM_002693.2:c.2794C>T, NM_002693.2:c.752C>T, NM_002693.2:c.3644-1G>A, NM_002693.2:c.1879C>T, NM_002693.2:c.2605C>T, NM_002693.2:c.911T>G, NM_002693.2:c.1760C>T, NM_002693.2:c.2542G>A, NM_002693.2:c.1550G>T, NM_002693.2:c.2557C>T, NM_002693.2:c.2207A>G, NM_002693.2:c.2243G>C, NM_002693.2:c.2209G>C250,600
POMGNT1Distrofia muscular (congénita asociada a anomalías cerebrales y oculares) tipo A3NM_017739.3NM_017739.3:c.1425G>A, NM_017739.3:c.1545delC, NM_017739.3:c.1274G>C, NM_017739.3:c.1864delC, NM_017739.3:c.1411A>T, NM_017739.3:c.1469G>A, NM_017739.3:c.1539+1G>A, NM_017739.3:c.92dupA, NM_017739.3:c.1539+1G>T, NM_017739.3:c.932G>A, NM_017739.3:c.794G>A, NM_017739.3:c.880-1G>A, NM_017739.3:c.652+1G>A, NM_017739.3:c.931C>T, NM_017739.3:c.1666G>A, NM_017739.3:c.1814G>C, NM_017739.3:c.636C>T, NM_017739.3:c.187C>T250,600
POMT1Distrofia muscular congénita con déficit intelectual tipo B1NM_007171.3NM_007171.3:c.598G>C, NM_007171.3:c.193G>A, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.1746G>C, NM_007171.3:c.793C>T250,600
POMT1Síndrome de Walker-WarburgNM_007171.3NM_007171.3:c.1540C>T, NM_007171.3:c.226G>A, NM_007171.3:c.1611C>G, NM_007171.3:c.1242-2A>G, NM_007171.3:c.907C>T, NM_007171.3:c.2163_2164insG, NM_007171.3:c.2167dupG, NM_007171.3:c.1153C>T, NM_007171.3:c.1261_1262insC, NM_007171.3:c.831C>G, NM_007171.3:c.1545C>G, NM_007171.3:c.1280_1281delAGinsTC250,600
POMT2Distrofia muscular congénita con déficit intelectual tipo A2NM_013382.5NM_013382.5:c.2243G>C, NM_013382.5:c.1997A>G, NM_013382.5:c.2242T>C, NM_013382.5:c.1445G>T, NM_013382.5:c.2177G>A, NM_013382.5:c.1238G>C, NM_013382.5:c.1941G>A, NM_013382.5:c.1057G>A, NM_013382.5:c.551C>T250,600
POMT2Síndrome de Walker-WarburgNM_013382.5NM_013382.5:c.1726-2A>G, NM_013382.5:c.1417C>T, NM_013382.5:c.1912C>T, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1045_1052delinsG250,600
POU1F1Déficit combinados de hormonas hipofisarias tipo 1NM_000306.3NM_000306.3:c.472G>C, NM_000306.3:c.428G>A, NM_000306.3:c.577T>C, NM_000306.3:c.514C>T, NM_000306.3:c.515G>A, NM_000306.3:c.71C>T, NM_000306.3:c.433A>T, NM_000306.3:c.715C>T, NM_000306.3:c.515G>C, NM_000306.3:c.391G>T, NM_000306.3:c.688G>A, NM_000306.3:c.793C>T, NM_000306.3:c.748G>T, NM_000306.3:c.811C>T, NM_000306.3:c.404T>G600
POU3F4Sordera ligada al X tipo 2NM_000307.4NM_000307.4:c.604A>T, NM_000307.4:c.499C>T600
PPT1Lipofuscinosis neuronal ceroide tipo 1NM_000310.3NM_000310.3:c.29T>A, NM_000310.3:c.223A>C, NM_000310.3:c.627+1G>T, NM_000310.3:c.169_170insA, NM_000310.3:c.451C>T, NM_000310.3:c.541G>T, NM_000310.3:c.840_841insA250,600
PRCDRetinosis pigmentaria 36NM_001077620.2NM_001077620.2:c.64C>T, NM_001077620.2:c.52C>T600
PRKRADistonía tipo 16NM_003690.4NM_003690.4:c.665C>T600
PRODHHiperprolinemia tipo 1NM_016335.4NM_016335.4:c.865T>A, NM_016335.4:c.1331G>A250,600
PROM1Retinosis pigmentaria tipo 41NM_006017.2NM_006017.2:c.1841delG, NM_006017.2:c.1354_1355insT, NM_006017.2:c.1726C>T, NM_006017.2:c.199C>T, NM_006017.2:c.2490-2A>G, NM_006017.2:c.1177_1178delAT250,600
PROP1Déficit combinados de hormonas hipofisarias tipo 2NM_006261.4NM_006261.4:c.2T>C, NM_006261.4:c.150delA, NM_006261.4:c.349T>A, NM_006261.4:c.112_124delTCGAGTGCTCCAC, NM_006261.4:c.310delC, NM_006261.4:c.343-11C>G, NM_006261.4:c.217C>T, NM_006261.4:c.218G>A, NM_006261.4:c.373C>T, NM_006261.4:c.157delA, NM_006261.4:c.295C>T, NM_006261.4:c.469_470insT, NM_006261.4:c.301_302delAG, NM_006261.4:c.358C>T, NM_006261.4:c.247C>T, NM_006261.4:c.263T>C, NM_006261.4:c.4delG600
PRPS1Enfermedad de Charcot Marie Tooth tipo 5 recesiva ligada al XNM_002764.3NM_002764.3:c.344T>C600
PRPS1Sordera ligada al XNM_002764.3NM_002764.3:c.916G>A, NM_002764.3:c.869T>C600
PRPS1Superactividad de fosforibosilfosfato sintasaNM_002764.3NM_002764.3:c.398A>C, NM_002764.3:c.455T>C600
PRPS1Sordera neurosensorial no sindrómica ligada al XNM_002764.3NM_002764.3:c.193G>A600
PRXEnfermedad de Charcot-Marie-Tooth tipo 4FNM_181882.2NM_181882.2:c.2553_2556delTCTC, NM_181882.2:c.1362delA, NM_181882.2:c.1951G>A, NM_181882.2:c.3208C>T, NM_181882.2:c.2145T>A, NM_181882.2:c.2098delG600
PRXSíndrome de Dejerine-Sottas (PRX)NM_181882.2NM_181882.2:c.247delC, NM_181882.2:c.1102C>T, NM_181882.2:c.2857C>T600
PSAPEnfermedad de Gaucher atípica por deficiencia de saposina CNM_002778.2NM_002778.2:c.643A>C, NM_002778.2:c.607C>T, NM_002778.2:c.1A>T, NM_002778.2:c.1046T>C, NM_002778.2:c.1288C>T600
PSAT1Déficit de fosfoserina aminotransferasaNM_058179.3NM_058179.3:c.1029_1030delCT, NM_058179.3:c.299A>C600
PYGMEnfermedad de McArdleNM_005609.2NM_005609.2:c.1628A>C, NM_005609.2:c.1466C>G, NM_005609.2:c.1094C>T, NM_005609.2:c.1827G>A, NM_005609.2:c.13_14delCT, NM_005609.2:c.1A>G, NM_005609.2:c.2009C>T, NM_005609.2:c.2128_2130delTTC, NM_005609.2:c.393delG, NM_005609.2:c.2392T>C, NM_005609.2:c.148C>T, NM_005609.2:c.1621G>T, NM_005609.2:c.613G>A, NM_005609.2:c.1963G>A, NM_005609.2:c.2262delA, NM_005609.2:c.1722T>G, NM_005609.2:c.255C>A, NM_005609.2:c.280C>T, NM_005609.2:c.1768+1G>A, NM_005609.2:c.501dupT, NM_005609.2:c.481C>T, NM_005609.2:c.1726C>T250,600
RAB23Síndrome de CarpenterNM_183227.2NM_183227.2:c.407dupC, NM_183227.2:c.434T>A600
RAB27AEnfermedad de Griscelli tipo 2NM_004580.4NM_004580.4:c.259G>C, NM_004580.4:c.382dupA, NM_004580.4:c.217T>G, NM_004580.4:c.352C>T, NM_004580.4:c.389T>C, NM_004580.4:c.454G>C600
RAB3GAP1Síndrome de micro Warburg tipo 1NM_012233.2NM_012233.2:c.1734G>A, NM_012233.2:c.496_497delTT, NM_012233.2:c.937dupA, NM_012233.2:c.1393_1396delTGTA, NM_012233.2:c.1410C>A, NM_012233.2:c.899+1G>A, NM_012233.2:c.2011C>T, NM_012233.2:c.748+1G>A600
RAB3GAP2Síndrome de micro Warburg tipo 2NM_012414.3NM_012414.3:c.1648C>T, NM_012414.3:c.1485C>A, NM_012414.3:c.325_328delAAAG, NM_012414.3:c.1276C>T600
RAD51CAnemia de Fanconi grupo de complementación ONM_058216.2NM_058216.2:c.706-2A>G, NM_058216.2:c.838-2A>T, NM_058216.2:c.133G>A, NM_058216.2:c.773G>A600
RAG1Inmunodeficiencia combinada grave célula B negativaNM_000448.2NM_000448.2:c.2333G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2164G>A, NM_000448.2:c.940C>T, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T, NM_000448.2:c.2326C>T250,600
RAG1Síndrome de OmennNM_000448.2NM_000448.2:c.983G>A, NM_000448.2:c.3016A>G, NM_000448.2:c.256_257delAA, NM_000448.2:c.1682G>A, NM_000448.2:c.1681C>T250,600
RAG2Inmunodeficiencia combinada grave con granulomas en la pielNM_000536.3NM_000536.3:c.115A>G, NM_000536.3:c.686G>A, NM_000536.3:c.283G>A, NM_000536.3:c.601C>T, NM_000536.3:c.230C>A, NM_000536.3:c.1352G>C600
RAG2Síndrome de OmennNM_000536.3NM_000536.3:c.685C>T, NM_000536.3:c.1504A>G600
RAPSNSíndromes miasténicos congénitos postsinápticosNM_005055.4NM_005055.4:c.484G>A, NM_005055.4:c.264C>A, NM_005055.4:c.807C>A, NM_005055.4:c.848T>C, NM_005055.4:c.490C>T, NM_005055.4:c.603C>A250,600
RAPSNSecuencia deformante de aquinesia fetalNM_005055.4NM_005055.4:c.416T>C, NM_005055.4:c.566C>T250,600
RAXMicroftalmia aislada tipo 3NM_013435.2NM_013435.2:c.909C>G, NM_013435.2:c.18C>A, NM_013435.2:c.197G>C, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG250,600
RDH12Amaurosis congénita de Leber tipo 13NM_152443.2NM_152443.2:c.184C>T, NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.451C>A, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.805_809delGCCCT, NM_152443.2:c.164C>T, NM_152443.2:c.210dupC, NM_152443.2:c.448+1_448+4delGTAA, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C250,600
RDXSordera tipo 24, autosómico recesivaNM_002906.3NM_002906.3:c.1405dupG, NM_002906.3:c.342_346delGATAT600
RELNSíndrome de lisencefalia tipo Norman-RobertsNM_005045.3NM_005045.3:c.6646C>T, NM_005045.3:c.5615-1G>A600
RENDisgenesia tubular renalNM_000537.3NM_000537.3:c.404C>A, NM_000537.3:c.127C>T, NM_000537.3:c.145C>T600
RGRRetinosis pigmentaria tipo 44NM_001012720.1NM_001012720.1:c.196A>C, NM_001012720.1:c.249_250insGGCTCGGA, NM_001012720.1:c.261_262insGGCTCGGA, NM_001012720.1:c.454C>A, NM_001012720.1:c.865C>T, NM_001012720.1:c.877C>T250,600
RHORetinosis pigmentaria tipo 4NM_000539.3NM_000539.3:c.152G>C, NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.670G>A, NM_000539.3:c.745G>T, NM_000539.3:c.659T>G250,600
RLBP1Retinitis punctata albescensNM_000326.4NM_000326.4:c.333T>G, NM_000326.4:c.452G>A, NM_000326.4:c.700C>T, NM_000326.4:c.875C>T250,600
RP2Retinosis pigmentaria tipo 2NM_006915.2NM_006915.2:c.235delG, NM_006915.2:c.305_306insT, NM_006915.2:c.352delC, NM_006915.2:c.353G>A, NM_006915.2:c.353G>T, NM_006915.2:c.358C>T, NM_006915.2:c.453C>G, NM_006915.2:c.453delC, NM_006915.2:c.631delC600
RPE65Amaurosis congénita de Leber tipo 2NM_000329.2NM_000329.2:c.1067delA, NM_000329.2:c.1301C>T, NM_000329.2:c.1292A>G, NM_000329.2:c.272G>A, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT250,600
RPE65Retinosis pigmentaria tipo 20NM_000329.2NM_000329.2:c.1022T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1102T>C, NM_000329.2:c.271C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1543C>T, NM_000329.2:c.394G>A, NM_000329.2:c.881A>C250,600
RPGRRetinosis pigmentaria tipo 3NM_001034853.1NM_001034853.1:c.155-2A>G, NM_001034853.1:c.173_174insA, NM_001034853.1:c.179G>T, NM_001034853.1:c.296C>A, NM_001034853.1:c.389T>G, NM_001034853.1:c.505G>T, NM_001034853.1:c.517G>C, NM_001034853.1:c.642_656delTGGAGAACCTGAGAAinsC, NM_001034853.1:c.654_655delGA, NM_001034853.1:c.674_675delCC, NM_001034853.1:c.703C>T, NM_001034853.1:c.806G>A, NM_001034853.1:c.823G>A, NM_001034853.1:c.846_847delAA600
RPGRIP1LSíndrome de Joubert tipo 7NM_015272.2NM_015272.2:c.1177G>A, NM_015272.2:c.1326_1329delAAAA, NM_015272.2:c.1329_1330insA, NM_015272.2:c.1843A>C, NM_015272.2:c.1975T>C, NM_015272.2:c.2030C>T, NM_015272.2:c.2050C>T, NM_015272.2:c.2413C>T, NM_015272.2:c.757C>T, NM_015272.2:c.3548C>G, NM_015272.2:c.697A>T, NM_015272.2:c.3634_3637delGAAA, NM_015272.2:c.776+1G>A, NM_015272.2:c.2794_2795delTT250,600
RPGRIP1LSíndrome de Meckel tipo 5NM_015272.2NM_015272.2:c.394A>T, NM_015272.2:c.3706C>T, NM_015272.2:c.2614C>T250,600
RYR1Miopatía congénita central coreNM_000540.2NM_000540.2:c.1021G>A, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.10616G>A, NM_000540.2:c.11798A>G, NM_000540.2:c.1205T>C, NM_000540.2:c.13480G>T, NM_000540.2:c.13513G>C, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14511+1_14511+2delGT, NM_000540.2:c.14545G>A, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.325C>T, NM_000540.2:c.4076delG, NM_000540.2:c.4178A>G, NM_000540.2:c.4405C>T, NM_000540.2:c.487C>T, NM_000540.2:c.5036G>A, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.6961A>G, NM_000540.2:c.7025A>G, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.738T>G, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.9000+1G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.1655G>A, NM_000540.2:c.4729G>A, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.8360C>G, NM_000540.2:c.9868G>A, NM_000540.2:c.9905_9906insC, NM_000540.2:c.1186G>T, NM_000540.2:c.6721C>T250,600
SACSAtaxia espástica tipo Charlevoix-SaguenayNM_014363.5NM_014363.5:c.10907G>A, NM_014363.5:c.10954C>A, NM_014363.5:c.11624G>A, NM_014363.5:c.12160C>T, NM_014363.5:c.517C>T, NM_014363.5:c.6355C>T, NM_014363.5:c.6781C>A, NM_014363.5:c.7504C>T, NM_014363.5:c.8107C>T, NM_014363.5:c.8844delT, NM_014363.5:c.994A>T, NM_014363.5:c.13237C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.4933C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.6563T>A250,600
SAGEnfermedad de OguchiNM_000541.4NM_000541.4:c.293_294insG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G250,600
SBDSSíndrome de Shwachman-DiamondNM_016038.2NM_016038.2:c.120delG, NM_016038.2:c.127G>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.184A>T, NM_016038.2:c.377G>C, NM_016038.2:c.505C>T, NM_016038.2:c.258+2T>C250,600
SBF2Enfermedad de Charcot-Marie-Tooth tipo 4B2NM_030962.3NM_030962.3:c.1459C>T, NM_030962.3:c.2875C>T, NM_030962.3:c.3586C>T, NM_030962.3:c.3154A>T, NM_030962.3:c.5539_5540insATCT600
SC5DLatosterolosisNM_006918.4NM_006918.4:c.86G>A600
SCNN1APseudohipoaldosteronismo tipo 1NM_001038.5NM_001038.5:c.1305delC, NM_001038.5:c.1482delC, NM_001038.5:c.1522C>T, NM_001038.5:c.1765C>T, NM_001038.5:c.1834C>T, NM_001038.5:c.203_204delTC, NM_001038.5:c.340G>A600
SCNN1BPseudohipoaldosteronismo tipo 1NM_000336.2NM_000336.2:c.109G>A250,600
SCNN1GPseudohipoaldosteronismo tipo 1NM_001039.3NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG, NM_001039.3:c.598_599insA250,600
SEMA4ARetinosis pigmentaria tipo 35NM_022367.3NM_022367.3:c.1033G>C, NM_022367.3:c.1049T>G600
SEPN1Distrofia muscular congénita, espina rígida tipo 1NM_020451.2NM_020451.2:c.1315C>T, NM_020451.2:c.818G>A, NM_020451.2:c.883G>A, NM_020451.2:c.943G>A, NM_020451.2:c.943G>C, NM_020451.2:c.1384T>G, NM_020451.2:c.713_714insA, NM_020451.2:c.871C>T600
SERPINA1Déficit de alfa-1 antitripsinaNM_000295.4NM_000295.4:c.1177C>T, NM_000295.4:c.187C>T, NM_000295.4:c.194T>C, NM_000295.4:c.230C>T, NM_000295.4:c.250G>A, NM_000295.4:c.272G>A, NM_000295.4:c.347T>A, NM_000295.4:c.415G>A, NM_000295.4:c.514G>A, NM_000295.4:c.514G>T, NM_000295.4:c.739C>T, NM_000295.4:c.839A>T, NM_000295.4:c.1093G>A, NM_000295.4:c.848A>T250,600
SETXAtaxia espinocerebelosa con neuropatía axonal tipo 2NM_015046.5NM_015046.5:c.1027G>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1807A>G, NM_015046.5:c.2602C>T, NM_015046.5:c.3880C>T, NM_015046.5:c.4087C>T, NM_015046.5:c.5630delG, NM_015046.5:c.5927T>G, NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.994C>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.5549-1G>T, NM_015046.5:c.6834_6839delAACAAA250,600
SGCADistrofia muscular de cinturas autosómica recesiva tipo 2DNM_000023.2NM_000023.2:c.101G>A, NM_000023.2:c.229C>T, NM_000023.2:c.371T>C, NM_000023.2:c.518T>C, NM_000023.2:c.574C>T, NM_000023.2:c.850C>T, NM_000023.2:c.662G>A, NM_000023.2:c.739G>A, NM_000023.2:c.904_905insCC250,600
SGCBDistrofia muscular de cinturas autosómica recesiva tipo 2ENM_000232.4NM_000232.4:c.272G>C, NM_000232.4:c.272G>T, NM_000232.4:c.299T>A, NM_000232.4:c.323T>G, NM_000232.4:c.341C>T, NM_000232.4:c.452C>G, NM_000232.4:c.552T>G600
SGCGDistrofia muscular de cinturas autosómica recesiva tipo 2CNM_000231.2NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A, NM_000231.2:c.88delG, NM_000231.2:c.521delT250,600
SGSHMucopolisacaridosis tipo 3A (Enfermedad de Sanfilippo tipo A)NM_000199.3NM_000199.3:c.1167C>A, NM_000199.3:c.1298G>A, NM_000199.3:c.130G>A, NM_000199.3:c.1339G>A, NM_000199.3:c.1380delT, NM_000199.3:c.197C>G, NM_000199.3:c.220C>T, NM_000199.3:c.235A>C, NM_000199.3:c.320delT, NM_000199.3:c.337_345delinsGCACAGGTGAG, NM_000199.3:c.364G>A, NM_000199.3:c.383C>T, NM_000199.3:c.416C>T, NM_000199.3:c.449G>A, NM_000199.3:c.466A>T, NM_000199.3:c.617G>C, NM_000199.3:c.752G>C, NM_000199.3:c.757delG, NM_000199.3:c.877C>T, NM_000199.3:c.892T>C250,600
SH2D1AEnfermedad linfoproliferativa tipo 1 ligada al XNM_002351.4NM_002351.4:c.163C>T, NM_002351.4:c.164G>T, NM_002351.4:c.172C>T, NM_002351.4:c.203C>T, NM_002351.4:c.302C>T, NM_002351.4:c.3G>T, NM_002351.4:c.95G>C600
SH3TC2Enfermedad de Charcot-Marie-Tooth tipo 4CNM_024577.3NM_024577.3:c.1586G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1969G>A, NM_024577.3:c.1972C>T, NM_024577.3:c.1982T>C, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.2191delG, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2710C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2860C>T, NM_024577.3:c.28delG, NM_024577.3:c.2993_2994insC, NM_024577.3:c.3325C>T, NM_024577.3:c.3326G>C, NM_024577.3:c.3341delC, NM_024577.3:c.3601C>T, NM_024577.3:c.3686A>T, NM_024577.3:c.505T>C, NM_024577.3:c.52+1delG, NM_024577.3:c.530-2A>G, NM_024577.3:c.735G>A, NM_024577.3:c.920G>A, NM_024577.3:c.3676-1G>A, NM_024577.3:c.1724T>A, NM_024577.3:c.53-1G>C250,600
SIL1Síndrome de Marinesco-SjogrenNM_022464.4NM_022464.4:c.1312C>T, NM_022464.4:c.274C>T, NM_022464.4:c.331C>T600
SIX6Anoftalmia o microftalmia aisladaNM_007374.2NM_007374.2:c.493A>G, NM_007374.2:c.532_536delAACCG, NM_007374.2:c.635C>T, NM_007374.2:c.725G>T600
SLC12A1Síndrome de Bartter tipo 1NM_000338.2NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805_2806insA, NM_000338.2:c.347G>A, NM_000338.2:c.611T>C, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.223C>T, NM_000338.2:c.2952_2955delCAAA250,600
SLC12A6Agenesia de cuerpo calloso con neuropatíaNM_133647.1NM_133647.1:c.1584_1585delCTinsG, NM_133647.1:c.2023C>T, NM_133647.1:c.3031C>T, NM_133647.1:c.619C>T, NM_133647.1:c.316+1G>A, NM_133647.1:c.366T>G600
SLC17A5Enfermedad de almacenamiento de ácido siálico libreNM_012434.4NM_012434.4:c.115C>T, NM_012434.4:c.406A>G, NM_012434.4:c.43G>T, NM_012434.4:c.918T>G, NM_012434.4:c.1259+1G>A, NM_012434.4:c.500T>C250,600
SLC24A1Ceguera nocturna estacionaria congénita tipo 1DNM_004727.2NM_004727.2:c.1963C>T250,600
SLC25A13Citrulinemia tipo 2NM_014251.2NM_014251.2:c.1078C>T, NM_014251.2:c.1177+1G>A, NM_014251.2:c.1311+1G>A, NM_014251.2:c.1592G>A, NM_014251.2:c.1799dupA, NM_014251.2:c.1801G>A, NM_014251.2:c.1801G>T, NM_014251.2:c.1813C>T, NM_014251.2:c.615+1G>C, NM_014251.2:c.615+5G>A, NM_014251.2:c.674C>A, NM_014251.2:c.674C>T, NM_014251.2:c.852_855delTATG, NM_014251.2:c.1231-1G>A, NM_014251.2:c.1411_1412delCT600
SLC25A15Síndrome de Hiperornitinemia - hiperamonemia - homocitrulinuriaNM_014252.3NM_014252.3:c.110T>G, NM_014252.3:c.212T>A, NM_014252.3:c.535C>T, NM_014252.3:c.538G>A, NM_014252.3:c.562_564delTTC, NM_014252.3:c.569G>A, NM_014252.3:c.658G>A, NM_014252.3:c.815C>T, NM_014252.3:c.824G>A, NM_014252.3:c.44C>T600
SLC25A22Encefalopatía epiléptica infantil temprana tipo 3NM_024698.5NM_024698.5:c.617C>T, NM_024698.5:c.706G>T600
SLC26A2Acondrogénesis tipo 1BNM_000112.3NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.532C>T, NM_000112.3:c.2033G>T250,600
SLC26A2Atelosteogenesis tipo 2NM_000112.3NM_000112.3:c.1535C>A, NM_000112.3:c.835C>T250,600
SLC26A2Displasia diastróficaNM_000112.3NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1361A>C, NM_000112.3:c.767T>C, NM_000112.3:c.833delC, NM_000112.3:c.496G>A, NM_000112.3:c.1957T>A250,600
SLC26A4Sordera tipo 4 autosómica recesivaNM_000441.1NM_000441.1:c.1001G>T, NM_000441.1:c.1034T>A, NM_000441.1:c.2162C>T, NM_000441.1:c.1975G>C, NM_000441.1:c.1174A>T, NM_000441.1:c.2131G>A, NM_000441.1:c.1454C>T, NM_000441.1:c.1468A>C, NM_000441.1:c.2211G>C, NM_000441.1:c.269C>T, NM_000441.1:c.916dupG, NM_000441.1:c.281C>T, NM_000441.1:c.1634T>G, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1489G>A, NM_000441.1:c.961A>T, NM_000441.1:c.2048T>C, NM_000441.1:c.898A>C, NM_000441.1:c.918+2T>C, NM_000441.1:c.1001+1G>T, NM_000441.1:c.970A>T, NM_000441.1:c.563T>C250,600
SLC26A4Síndrome de PendredNM_000441.1NM_000441.1:c.1246A>C, NM_000441.1:c.1826T>G, NM_000441.1:c.1229C>T, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1061T>C, NM_000441.1:c.1790T>C, NM_000441.1:c.2168A>G, NM_000441.1:c.1151A>G, NM_000441.1:c.1226G>A, NM_000441.1:c.1003T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.554G>C, NM_000441.1:c.626G>T, NM_000441.1:c.1334T>G, NM_000441.1:c.1198delT, NM_000441.1:c.412G>T, NM_000441.1:c.707T>C250,600
SLC26A5Sordera tipo 61, autosómica recesivaNM_198999.2NM_198999.2:c.209G>A, NM_198999.2:c.390A>C, NM_198999.2:c.152+1G>A, NM_198999.2:c.1A>G600
SLC35A1Trastorno congénito de la glicosilación tipo 2FNM_006416.4NM_006416.4:c.277_280delGTGCinsTG600
SLC35C1trastorno congénito de la glicosilación tipo 2cNM_018389.4NM_018389.4:c.439C>T, NM_018389.4:c.91G>T, NM_018389.4:c.923C>G, NM_018389.4:c.290dupG, NM_018389.4:c.503_505delTCT600
SLC35D1Displasia de SchneckenbeckenNM_015139.2NM_015139.2:c.319C>T, NM_015139.2:c.932G>A600
SLC37A4Enfermedad de almacenamiento de glucógeno tipos 1b, 1c y 1dNM_001164278.1NM_001164278.1:c.1042_1043delCT, NM_001164278.1:c.1081G>T, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1309C>T, NM_001164278.1:c.287G>A, NM_001164278.1:c.352T>C, NM_001164278.1:c.593A>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.83G>A, NM_001164278.1:c.899G>A250,600
SLC45A2Albinismo oculocutáneo tipo 4NM_016180.3NM_016180.3:c.1121delT, NM_016180.3:c.469G>A, NM_016180.3:c.986delC600
SLC4A11Distrofia endotelial hereditaria congénita tipo 2NM_032034.3NM_032034.3:c.1038_1039insA, NM_032034.3:c.1391G>A, NM_032034.3:c.2318C>T, NM_032034.3:c.1466C>T, NM_032034.3:c.1813C>T, NM_032034.3:c.2264G>A, NM_032034.3:c.2605C>T, NM_032034.3:c.2399C>T, NM_032034.3:c.554_561delGCTTCGCC, NM_032034.3:c.2606G>A250,600
SLC4A11Distrofia de córnea - sordera de percepciónNM_032034.3NM_032034.3:c.2528T>C, NM_032034.3:c.1463G>A, NM_032034.3:c.473_480delGCTTCGCC, NM_032034.3:c.2566A>G, NM_032034.3:c.637T>C, NM_032034.3:c.625C>T, NM_032034.3:c.2224G>A, NM_032034.3:c.2240_2240+1insTATGACAC250,600
SLC6A8Síndrome de deficiencia de transportador de creatina tipo 1NM_005629.3NM_005629.3:c.1011C>G, NM_005629.3:c.1141G>C, NM_005629.3:c.1222_1224delTTC, NM_005629.3:c.1540C>T, NM_005629.3:c.321_323delCTT, NM_005629.3:c.395G>T600
SLX4Anemia de Fanconi grupo de complementación PNM_032444.2NM_032444.2:c.1093delC, NM_032444.2:c.286delA, NM_032444.2:c.4921_4922insG, NM_032444.2:c.5097_5098delTC, NM_032444.2:c.5408_5409insAC, NM_032444.2:c.4739+1G>T, NM_032444.2:c.2808_2809delAG250,600
SMN1Atrofia muscular espinal-del ex7, del ex7-8, del ex8 (Detección por MLPA)250,600
SMPD1Enfermedad de Niemann-PickNM_000543.4NM_000543.4:c.103_118delCTGGTGCTGGCGCTGG, NM_000543.4:c.103_119delCTGGTGCTGGCGCTGGC, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.103_113delCTGGTGCTGGCGinsCTGGTG, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.106delG, NM_000543.4:c.108_124delGCTGGCGCTGGCGCTGGC, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.551C>T, NM_000543.4:c.557C>T, NM_000543.4:c.558_559insC, NM_000543.4:c.558_574delGCCCCCCAAACCCCCTA, NM_000543.4:c.564delC, NM_000543.4:c.573delT, NM_000543.4:c.689G>A, NM_000543.4:c.730G>A, NM_000543.4:c.739G>A, NM_000543.4:c.740delG, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.940G>A, NM_000543.4:c.96G>A, NM_000543.4:c.996delC, NM_000543.4:c.688C>T, NM_000543.4:c.995C>G, NM_000543.4:c.1829_1831delGCC, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1152G>A250,600
SNAI2Síndrome de Waardenburg tipo 2DNM_003068.4NM_003068.4:c.357C>A600
SNAP29Síndrome de disgenesia cerebral - neuropatía - ictiosis - queratodermia palmoplantarNM_004782.3NM_004782.3:c.487dupA600
SPG11Paraplejia espástica tipo 11NM_025137.3NM_025137.3:c.118C>T, NM_025137.3:c.529_533delATATT, NM_025137.3:c.5623C>T, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.342delT, NM_025137.3:c.7152-1G>C, NM_025137.3:c.733_734delAT, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.1736-1G>C, NM_025137.3:c.6100C>T, NM_025137.3:c.6848_6849insTC250,600
SPG20Paraplejía espástica autosómica recesiva tipo 20NM_015087.4NM_015087.4:c.1110delA, NM_015087.4:c.364_365delAT600
SPG7Paraplejia espástica tipo 7NM_003119.3NM_003119.3:c.1457G>A, NM_003119.3:c.1529C>T, NM_003119.3:c.2075G>C, NM_003119.3:c.233T>A, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.286+1G>T250,600
STARHiperplasia suprarrenal congénita lipoideNM_000349.2NM_000349.2:c.545G>T, NM_000349.2:c.559G>A, NM_000349.2:c.545G>A, NM_000349.2:c.749G>A, NM_000349.2:c.772C>T, NM_000349.2:c.562C>T, NM_000349.2:c.577C>T600
STILMicrocefalia primaria tipo 7 autosómica recesivaNM_003035.2NM_003035.2:c.3655delG, NM_003035.2:c.3715C>T, NM_003035.2:c.3843_3846delACAG, NM_003035.2:c.2392T>G, NM_003035.2:c.2826+1G>A600
STRA6Microftalmia sindrómica tipo 9NM_022369.3NM_022369.3:c.1678G>C, NM_022369.3:c.1699C>T, NM_022369.3:c.147delC, NM_022369.3:c.1521-1G>A, NM_022369.3:c.1964G>A, NM_022369.3:c.277_278insCC, NM_022369.3:c.1931C>T, NM_022369.3:c.1963C>T, NM_022369.3:c.69G>A, NM_022369.3:c.878C>T, NM_022369.3:c.910_911delGGinsAA, NM_022369.3:c.52_53delTAinsC, NM_022369.3:c.527_528insG600
STRCSordera tipo 16 autosómica recesivaNM_153700.2NM_153700.2:c.4561_4562insC, NM_153700.2:c.5188C>T, NM_153700.2:c.3556C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.5185C>T, NM_153700.2:c.4545+1G>C250,600
SUCLG1Acidosis láctica infantil fatal con aciduria metilmalónicaNM_003849.3NM_003849.3:c.152_153delAT, NM_003849.3:c.626C>A600
SUOXSulfocisteinuriaNM_000456.2NM_000456.2:c.37C>T, NM_000456.2:c.894_895delCT, NM_000456.2:c.650G>A, NM_000456.2:c.794C>A600
TAF1Distonía-parkinsonismo ligado al XNM_004606.4NM_004606.4:c.417_418insCATAATCTATGATAATGATAAT600
TATTirosinemia tipo 2NM_000353.2NM_000353.2:c.1249C>T, NM_000353.2:c.236-5A>G, NM_000353.2:c.668C>G, NM_000353.2:c.1297C>T, NM_000353.2:c.169C>T600
TBCESíndrome de hipoparatiroidismo - déficit intelectual - dismorfismoNM_003193.4NM_003193.4:c.1491_1492insGTAAA600
TCAPCardiomiopatía, hipertrófica, tipo 25NM_003673.3NM_003673.3:c.260G>A, NM_003673.3:c.316C>T250,600
TCAPDistrofia muscular de cinturas autosómica recesiva tipo 2GNM_003673.3NM_003673.3:c.157C>T250,600
TCIRG1Osteopetrosis tipo 1 autosómica recesivaNM_006019.3NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.179A>G, NM_006019.3:c.2236+1G>A, NM_006019.3:c.2415-3C>G, NM_006019.3:c.112_113delAG, NM_006019.3:c.1213G>A250,600
TECTASordera neurosensorial autosómica recesiva tipo 21NM_005422.2NM_005422.2:c.2428C>T, NM_005422.2:c.2941+1G>A, NM_005422.2:c.651_652insC, NM_005422.2:c.4370_4371insTCAGTGCGACCCGC, NM_005422.2:c.4601G>A600
TERTDisqueratosis congénita autosomica recesivaNM_198253.2NM_198253.2:c.1234C>T, NM_198253.2:c.835G>A, NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T250,600
TFR2Hemocromatosis tipo 3NM_003227.3NM_003227.3:c.1330G>A, NM_003227.3:c.1403G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.2343G>A, NM_003227.3:c.313C>T, NM_003227.3:c.1665delC, NM_003227.3:c.750C>G, NM_003227.3:c.840C>G, NM_003227.3:c.949C>T, NM_003227.3:c.515T>A, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.2014C>T, NM_003227.3:c.2374G>A, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1186C>T250,600
THSíndrome de Segawa autosómico recesivoNM_000360.3NM_000360.3:c.1141C>A, NM_000360.3:c.614T>C, NM_000360.3:c.733A>C, NM_000360.3:c.1388C>T, NM_000360.3:c.605G>A, NM_000360.3:c.917G>A600
TIMM8ASíndrome de Mohr-TranebjaergNM_004085.3NM_004085.3:c.198C>G, NM_004085.3:c.238C>T, NM_004085.3:c.112C>T600
TK2Síndrome de depleción del ADN mitocondrial tipo 2NM_004614.4NM_004614.4:c.323C>T, NM_004614.4:c.361C>A, NM_004614.4:c.373C>T, NM_004614.4:c.500G>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.635T>A, NM_004614.4:c.623A>G, NM_004614.4:c.159C>G, NM_004614.4:c.268C>T250,600
TMC1Sordera tipo 7 autosómica recesivaNM_138691.2NM_138691.2:c.1763+3A>G, NM_138691.2:c.1842G>A, NM_138691.2:c.100C>T, NM_138691.2:c.1165C>T, NM_138691.2:c.425G>A, NM_138691.2:c.454-1G>C, NM_138691.2:c.1960A>G600
TMEM216Síndrome de Joubert tipo 2NM_001173990.2NM_001173990.2:c.218G>T, NM_001173990.2:c.218G>A, NM_001173990.2:c.79_82delAACG600
TMEM216Síndrome de Meckel tipo 2NM_001173990.2NM_001173990.2:c.230G>C, NM_001173990.2:c.253C>T, NM_001173990.2:c.341T>G600
TMEM67Síndrome de COACHNM_153704.5NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C250,600
TMEM67Síndrome de Joubert tipo 6NM_153704.5NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.1538A>G250,600
TMEM67Síndrome de Meckel tipo 3NM_153704.5NM_153704.5:c.1309C>G, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.653G>C, NM_153704.5:c.406+1402_406+1403insTAAT, NM_153704.5:c.622A>T250,600
TMIESordera neurosensorial autosómica recesiva tipo 6NM_147196.2NM_147196.2:c.241C>T, NM_147196.2:c.250C>T, NM_147196.2:c.170G>A, NM_147196.2:c.257G>A600
TMPRSS3Sordera tipos 8/10 autosómica recesivaNM_024022.2NM_024022.2:c.1211C>T, NM_024022.2:c.1276G>A, NM_024022.2:c.1159G>A, NM_024022.2:c.413C>A, NM_024022.2:c.446+1G>T, NM_024022.2:c.647G>T, NM_024022.2:c.753G>C, NM_024022.2:c.646C>T, NM_024022.2:c.208delC, NM_024022.2:c.242C>G250,600
TNNT1Miopatía nemalínica tipo 5NM_003283.5NM_003283.5:c.538G>T600
TPP1Lipofuscinosis neuronal ceroide tipo 2NM_000391.3NM_000391.3:c.1093T>C, NM_000391.3:c.616C>T, NM_000391.3:c.622C>T, NM_000391.3:c.1340G>A, NM_000391.3:c.141_144delGAGT, NM_000391.3:c.827A>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.851G>T250,600
TPRNSordera neurosensorial autosómica recesiva tipo 79NM_001128228.2NM_001128228.2:c.1427delC, NM_001128228.2:c.1239G>A600
TREX1Síndrome de Aicardi-Goutières tipo 1NM_033629.4NM_033629.4:c.341G>A, NM_033629.4:c.144_145insC, NM_033629.4:c.490C>T, NM_033629.4:c.506G>A600
TRIM32Distrofia muscular de cinturas autosómica recesiva tipo 2HNM_012210.3NM_012210.3:c.1459G>A, NM_012210.3:c.1560delC600
TRIM37Enanismo MulibreyNM_015294.3NM_015294.3:c.1346_1347insA, NM_015294.3:c.1411C>T, NM_015294.3:c.1037_1040dupAGAT, NM_015294.3:c.2056C>T, NM_015294.3:c.2212delG, NM_015294.3:c.227T>C, NM_015294.3:c.326G>C, NM_015294.3:c.496_500delAGGAA, NM_015294.3:c.745C>T, NM_015294.3:c.965G>T, NM_015294.3:c.1478_1479delAG, NM_015294.3:c.1668-1G>C600
TRIOBPSordera tipo 28 autosómica recesivaNM_001039141.2NM_001039141.2:c.2362C>T, NM_001039141.2:c.3194delT, NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.4577C>G, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.5316G>A, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4429_4430insG250,600
TSEN54Hipoplasia pontocerebelosaNM_207346.2NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T250,600
TSFMDéficit combinado de la fosforilación oxidativa tipo 3NM_001172696.1NM_001172696.1:c.1_2delAT, NM_001172696.1:c.580delC, NM_001172696.1:c.919C>T, NM_001172696.1:c.21_22delGC250,600
TSHBDéficit aislado de la hormona estimulante de la tiroidesNM_000549.4NM_000549.4:c.94G>T, NM_000549.4:c.205C>T, NM_000549.4:c.145G>A600
TSHRHipotiroidismoNM_000369.2NM_000369.2:c.100G>A, NM_000369.2:c.1170T>G, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.122G>C, NM_000369.2:c.326G>A, NM_000369.2:c.1741_1742insC, NM_000369.2:c.202C>T250,600
TTNCardiopatía dilatada/Distrofia muscular tibialNM_133378.4NM_133378.4:c.13149C>A, NM_133378.4:c.22246G>A, NM_133378.4:c.31780G>A, NM_133378.4:c.40211dupT, NM_133378.4:c.44668delG, NM_133378.4:c.52977dupT, NM_133378.4:c.61640C>G, NM_133378.4:c.84669_84675delTGAATTC, NM_133378.4:c.94567C>T, NM_133378.4:c.96388C>T, NM_133378.4:c.96388delC, NM_133378.4:c.98366_98367delAT, NM_133378.4:c.12064C>T, NM_133378.4:c.28739-1G>A, NM_133378.4:c.3165-1G>T, NM_133378.4:c.4724_4728delTGAAA, NM_133378.4:c.48944-1G>A, NM_133378.4:c.91114_91117delTCCA, NM_133378.4:c.100185delA, NM_133378.4:c.40549delA, NM_133378.4:c.24568_24571delAGCA250,600
TTPAAtaxia con déficit de vitamina ENM_000370.3NM_000370.3:c.661C>T, NM_000370.3:c.744delA, NM_000370.3:c.575G>A250,600
TULP1Amaurosis congénita de Leber tipo 15NM_003322.4NM_003322.4:c.1198C>T, NM_003322.4:c.1204G>T600
TULP1Retinosis pigmentaria tipo 14NM_003322.4NM_003322.4:c.1259G>C, NM_003322.4:c.1318C>T, NM_003322.4:c.1471T>C, NM_003322.4:c.1511_1521delTGCAGTTCGGC, NM_003322.4:c.1376T>A, NM_003322.4:c.1444C>T600
TYRAlbinismo oculocutáneo tipo 1NM_000372.4NM_000372.4:c.1012_1013insC, NM_000372.4:c.1146C>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1147G>A, NM_000372.4:c.115T>G, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.140G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC, NM_000372.4:c.164G>A, NM_000372.4:c.1A>G, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.533G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.325G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A250,600
TYRP1Albinismo oculocutáneo tipo 3NM_000550.2NM_000550.2:c.107delT, NM_000550.2:c.1103delA, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1557T>G, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1120C>T, NM_000550.2:c.1369_1370insCAGA250,600
UBA1Atrofia muscular espinal tipo 2 ligada al XNM_003334.3NM_003334.3:c.1731C>T600
UBR1Síndrome de Johanson-BlizzardNM_174916.2NM_174916.2:c.869C>G, NM_174916.2:c.4254G>A, NM_174916.2:c.1281+1G>T, NM_174916.2:c.1537C>T600
UGT1A1Síndrome de Crigler-Najjar tipo 1NM_000463.2NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G250,600
UGT1A1Síndrome de Crigler-Najjar tipo 2NM_000463.2NM_000463.2:c.1207C>T, NM_000463.2:c.674T>G, NM_000463.2:c.1130G>T, NM_000463.2:c.524T>A, NM_000463.2:c.44T>G250,600
UGT1A1Gilbert syndromeNM_000463.2NM_000463.2:c.1211T>C, NM_000463.2:c.1456T>G250,600
UQCRQDéficit del complejo III mitocondrial, nuclear tipo 4NM_014402.4NM_014402.4:c.134C>T600
USH1CSíndrome de Usher tipo 1CNM_153676.3NM_153676.3:c.216G>A, NM_153676.3:c.2362G>A, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.238_239insC, NM_153676.3:c.238delC, NM_153676.3:c.2547-1G>T, NM_153676.3:c.2695_2696insAATTCACC, NM_153676.3:c.388G>A250,600
USH1GSíndrome de Usher tipo 1GNM_173477.4NM_173477.4:c.186_187delCA, NM_173477.4:c.394_395insG, NM_173477.4:c.832_851delTCGGACGAGGACAGCGTCTC, NM_173477.4:c.649C>T, NM_173477.4:c.805C>T600
USH2ARetinosis pigmentaria tipo 39NM_206933.2NM_206933.2:c.10073G>A, NM_206933.2:c.2296T>C, NM_206933.2:c.14519T>C, NM_206933.2:c.7364G>A, NM_206933.2:c.12574C>T, NM_206933.2:c.2276G>T250,600
USH2ASíndrome de Usher tipo 2ANM_206933.2NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.15371delT, NM_206933.2:c.2167+5G>A, NM_206933.2:c.11864G>A, NM_206933.2:c.14803C>T, NM_206933.2:c.2898delG, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.11549-5_11549-4insT, NM_206933.2:c.2299delG, NM_206933.2:c.5975A>G, NM_206933.2:c.6670G>T, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.779T>G, NM_206933.2:c.820C>T, NM_206933.2:c.8981G>A, NM_206933.2:c.956G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.15089C>A, NM_206933.2:c.2135delC, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.5573-2A>G, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.13709delG, NM_206933.2:c.14926G>A, NM_206933.2:c.15520-1G>A, NM_206933.2:c.8431C>A, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.14442C>A250,600
VDRRaquitismo dependiente de vitamina D tipo 2ANM_001017535.1NM_001017535.1:c.137G>A, NM_001017535.1:c.149G>A, NM_001017535.1:c.885C>A, NM_001017535.1:c.88C>T, NM_001017535.1:c.239G>A, NM_001017535.1:c.821G>T, NM_001017535.1:c.88C>G, NM_001017535.1:c.915C>G, NM_001017535.1:c.985G>A600
VLDLRSíndrome de ataxia cerebelosa - déficit intelectual - desequilibrio tipo 1NM_003383.3NM_003383.3:c.2339delT, NM_003383.3:c.2302_2303delGA, NM_003383.3:c.844C>T, NM_003383.3:c.769C>T600
VPS13ACoreoacantocitosisNM_033305.2NM_033305.2:c.622C>T, NM_033305.2:c.9109C>T, NM_033305.2:c.2898T>G, NM_033305.2:c.3091delG, NM_033305.2:c.9275+1G>T600
VPS33BArtrogriposis - disfunción renal - colestasis tipo 1NM_018668.4NM_018668.4:c.1246C>T, NM_018668.4:c.1312C>T, NM_018668.4:c.1498G>A, NM_018668.4:c.440_449delCTCTTGATGT, NM_018668.4:c.1594C>T, NM_018668.4:c.1480-1G>T, NM_018668.4:c.603+2T>A600
WASNeutropenia congénita grave ligada al XNM_000377.2NM_000377.2:c.881T>C, NM_000377.2:c.809T>C, NM_000377.2:c.814T>C600
WASTrombocitopenia tipo 1NM_000377.2NM_000377.2:c.167C>T, NM_000377.2:c.173C>G, NM_000377.2:c.1442T>A600
WASSíndrome de Wiskott-AldrichNM_000377.2NM_000377.2:c.134C>T600
WDR62Microcefalia primaria tipo 2 autosómica recesivaNM_001083961.1NM_001083961.1:c.1313G>A, NM_001083961.1:c.3514+1delG, NM_001083961.1:c.3574delA, NM_001083961.1:c.1408C>T, NM_001083961.1:c.193G>A, NM_001083961.1:c.702dupG, NM_001083961.1:c.671G>C, NM_001083961.1:c.557G>A600
WFS1Síndrome de WolframNM_006005.3NM_006005.3:c.1234_1237delGTCT, NM_006005.3:c.1511C>T, NM_006005.3:c.2168T>C, NM_006005.3:c.2171C>T, NM_006005.3:c.1944G>A, NM_006005.3:c.2084G>T, NM_006005.3:c.577A>C, NM_006005.3:c.676C>T, NM_006005.3:c.2327A>T, NM_006005.3:c.407_408insGGGCCGTCGCGAGGCT, NM_006005.3:c.2576G>A, NM_006005.3:c.2643_2644delCT, NM_006005.3:c.616C>T, NM_006005.3:c.1060_1062delTTC, NM_006005.3:c.400G>A, NM_006005.3:c.1943G>A, NM_006005.3:c.1230_1233delCTCT250,600
WNT10ADisplasia ectodérmica hipohidrótica autosómica recesivaNM_025216.2NM_025216.2:c.347T>C, NM_025216.2:c.383G>A, NM_025216.2:c.321C>A250,600
WNT10ADisplasia odonto-ónico-dérmicaNM_025216.2NM_025216.2:c.697G>T250,600
WNT7ASíndrome de FurhmannNM_004625.3NM_004625.3:c.874C>T600
WNT7AAplasia/hipoplasia de extremidades y pelvisNM_004625.3NM_004625.3:c.325G>A600
XPAXeroderma pigmentosa grupo de complementación ANM_000380.3NM_000380.3:c.323G>T, NM_000380.3:c.619C>T, NM_000380.3:c.727C>T, NM_000380.3:c.731A>G, NM_000380.3:c.348T>A, NM_000380.3:c.501delG600
ZFYVE26Paraplejía espástica tipo 15 autosómica recesivaNM_015346.3NM_015346.3:c.3206G>A, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.1477C>T, NM_015346.3:c.2887G>C, NM_015346.3:c.5422C>T, NM_015346.3:c.5485-1G>A, NM_015346.3:c.4312C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.3182delT, NM_015346.3:c.2114_2115insC250,600
ZMPSTE24Displasia mandibuloacral con lipodistrofia tipo BNM_005857.4NM_005857.4:c.121C>T, NM_005857.4:c.1263dupT, NM_005857.4:c.1018T>C, NM_005857.4:c.955-1G>A, NM_005857.4:c.1349G>A600
ZMPSTE24Dermopatía restrictiva letalNM_005857.4NM_005857.4:c.1076_1077insT, NM_005857.4:c.54dupT, NM_005857.4:c.1085_1086insT600
ZNF469Síndrome de córnea frágilNM_001127464.1NM_001127464.1:c.6673delC, NM_001127464.1:c.11452_11453insC, NM_001127464.1:c.4174G>T600
©2020 | Todos los derechos reservados. Nota legal | política de privacidad | Cookies policy